{version = 9.53; (* of merge 1989 May 1 *)}
(* begin module describe.merge *)
(*
name
merge: compare two files and merge them
synopsis
merge(afile: in, bfile: in, apfile: out, bpfile: out,
output: out, input: intty)
files
afile: the first input file
bfile: the second input file
apfile: the afile with corrections from bfile or the user
bpfile: the bfile with corrections from afile or the user
output: messages to the user
input: interactive input from the user.
description
the merge program was designed to aid in the entry of sequences.
merge will also compare any two files for differences.
two typed copies of the data are made (afile and bfile). merge will
compare the files, ignoring spaces and end-of-lines. this allows
the two data files to be typed independently by two people in two
formats. differences between the files are flagged, and the user
may then indicate which file is correct and merge will fix the other
file. the user may also modify the files using a small
editing facility. the changes go to the prime files (apfile, bpfile).
to be sure that apfile and bpfile are identical after the merge,
you can merge them again. several commands can be put on one line
separated by blanks. if you type an unrecognizable command, or ask for
help at any time then merge will list the commands available.
examples
when two sequences were compared, the program gave this output:
i am 91% sure that this has a deletion in b (insertion in a) of 5 characters:
file a: line 1
aatccttatccctcctaatttcgtttttgct
>iiiii< x at 9 insertion, 1 mismatch downstream
file b: line 1
aatccttacctaatttcctttttgct
>< x at 9 deletion, 1 mismatch downstream
the sequences matched before the points indicated. file a had
an insert of "tccct" followed several bases later by a c to g change.
the mismatch made merge less sure of the deletion.
one must look at the original sequence to make the correction.
author
thomas d. schneider
bugs
1. lines without any characters are not copied from the file to its
pfile. see procedure readline.
2. excessive blank characters may fool the guess procedure, since it
does not remove blanks before guessing. removing blanks would make
it difficult to autofix, and the spacings would be lost in the pfile.
3. the program can not compare more than one line from each file at a
time, so the guess is limited to what is visible on a line. the entire
program must be rewritten to allow multiple line guessing.
*)
(* end module describe.merge *)
{This manual page was created by makman 1.44}
{created by htmlink 1.55}
Viewing Files
Accessibility