program alist(inst, book, alistp, colors, namebook, namelist, avalues, list, clist, output); (* aligned listing of a book. Dr. Thomas D. Schneider National Institutes of Health National Cancer Institute Center for Cancer Research Nanobiology Program Molecular Information Theory Group Frederick, Maryland 21702-1201 toms@ncifcrf.gov permanent email: toms@alum.mit.edu (use only if first address fails) http://www.ccrnp.ncifcrf.gov/~toms/ module libraries: delman, delmods, prgmods *) label 1; (* end of program *) const (* begin module version *) version = 6.58; (* of alist.p 2007 Nov 29 2007 Nov 29: 6.58: ury of bounding box huge when multiple pages; fix page line ogic 2007 Jun 22: 6.57: 'The piece name in the book' - allow dotted names 2005 Sep 21: 6.56: emptyfile should reset the file so reads are ok! 2005 Sep 19: 6.55: cleanup 2005 Sep 19: 6.54: REALLY set the boundary at 2 characters in emptyfile. 2005 Sep 15: 6.53: set the boundary at 2 characters in emptyfile. 2005 Sep 15: 6.52: namewidth problem ... I kludged it for now. the namebook and namelist files normally would have at least 5 characters. So this was used as the test for 'empty'. See the emptyfile routine. The emptyfile routine replaces eof() in several places. 2005 Sep 13: 6.51: fix namewidth so it works with gpc! ... no must use new compiler. 2005 Sep 13: 6.50: delmod module upgrade 2005 Jan 27: 6.49: Abandon changes in 47 and 46, keep f function. It seems impossible to detect an empty file using the GPC compiler! THIS PROGRAM MUST BE COMILED WITH p2c (tc script)!!! 2005 Jan 27: 6.47: BUG: emptyfile routine to detect empty files. 2005 Jan 27: 6.46: BUG: In GPC, an empty file is not at eof when reset. How nice! So the namelistwidth failed. 2005 Jan 27: 6.45: postscript f function for setting fonts. 2004 Sep 8: 6.44: clean for GPC 2004 Aug 30: 6.43: maximum range set to 1001 2004 Jul 17: 6.42: delila mutation names not shown correctly 2004 Jul 11: 6.41: only display orientation if piece is given 2004 Jul 8: 6.40: upgrad to prgmod, isblank to work on all compilers 2004 Jul 7: 6.39: bug in reading bounding boxes 2004 Jun 7: 6.38: bounding box must be integers, not real 2002 Sep 5: 6.37: remove debugging residue, upgrade page boundaries 2002 Sep 5: 6.36: clean documentation 2002 Apr 19: 6.35: introduce line number control 2002 Jan 13: 6.34: upgrade documentation; mention version parameter line! 2001 Nov 5: 6.33: paging is NOT done to clist at all times! 2001 Aug 29: 6.32: edgecontrol variables written to clist are in cm 2001 Mar 26: 6.31: allow coordinate without piece name 2001 Mar 26: 6.30: check for 'program list header problem' neutralized. 2000 Nov 16: 6.28: fix reading of name instruction in delmod 2000 Nov 16: 6.27: gpc compatable! 2000 Oct 16: 6.26: increment maximumrange 2000 Jul 13: 6.25: tech notes about autoupgrade 2000 Jun 28: 6.24: headercontrol: 0 = no numbar 2000 Jun 24: 6.23: expand range to +/-1000 2000 Jun 24: 6.19: allow user to remove header by a parameter 2000 Jun 24: 6.12: precompute number oflines to make ghostview display tight. 2000 Jun 21: 6.07: full position of display controls installed, finally! 2000 Jun 21: 5.96: old parameter files are now automatically upgraded! 2000 Jun 20: 5.93: pnumberbar modified to use numberbar so it auto-upgrades! 2000 Jun 20: 5.90: introducing edgecontrol from makelogo 2000 May 10: 5.80: getname and printname now use getocp - very clean!!! 1999 Jul 24: 5.79: numberwidth is computed only in numbersize 1999 May 18: set bounding box for for the Canon Color Laser Copier 800S 1998 Oct 19: range set to 1000 origin before 1982 June 22 *) updateversion = 6.20; (* defines lowest acceptable current parameter file *) (* end module version *) (* begin module describe.alist *) (* name alist: aligned listing of a book synopsis alist(inst: in, book: in, alistp: inout, colors: in, namebook: in, namelist: in, avalues: in, list: out, clist: out, output: out) files inst: delila instructions of the form 'get from 56 -5 to 56 +10;' If this file is empty, then the sequences will be aligned either by their 5' ends or by their zero base, depending on the 4th parameter in alistp. book: the book generated by delila using inst alistp: parameters to control the program. If empty, the range of the instructions are used. Otherwise, 0. The version of alist that this parameter file is designed for. If the program finds an old version, it will *upgrade* the alistp file. 1. The first line contains one line with two integers defining the range of basesto display. This allows one to have a wide alignment, but look only at a portion. 2. If the first character of the second line is: 'p' the piece name and coordinates are given in the list. If it is ' ' then neither is given. If one has only one piece that one is working with, one may not want the piece name but will want the coordinate In this case use 'c'. If the second character is 'l', then the long name of the piece is given in the list preceeding the piece name. Note that this long name can be written into the book from the instructions by the Delila "name" instruction. (See in the libdef.) Blank names (ie, 'name "";') are accepted. 3. If the first character of the third line is 'n' then paging is not done to the list. 4. If the first character of the fourth line is 'f' (for 'first') then the sequences are always aligned by their first base. 'i' then the sequences are aligned by the delila instructions. If the inst file is empty, alignment is forced to the 'b' mode. 'b' (for 'internal') then the alignment is on the internal zero of the book's sequence. This option is to be used when "default coordinate zero" is used in the Delila instructions. The following table should clarify the cases and their uses: state |instructions empty | instructions exist ------|-------------------|------------------------------------------- | | instruction alignment | book alignment | | (def coo nor) | (def coo zer) |-------------------|------------------------|------------------ 'f' | first base | first base | first base | (first base) | (first base) | (first base) |-------------------|------------------------|------------------ 'i' | book | inst | inst (DO NOT USE) | (0) | (aligning base) | (aligning base) |-------------------|------------------------|------------------ 'b' | book | book (DO NOT USE) | book | (0) | (0) | (0) The first line of each entry defines how the alignment will be assigned. Thus 'f' forces the first base to be used at all times and 'b' forces the book to be used. In two case this does not make sense. First, if the instructions were generated with the "default coordinate zero", then the Delila instructions do not correspond to the base coordinates in the book (by definition) and so the alignment should not use the instruction file. In the second case, the instructions use "default coordinate normal" so the zero base in the book does not correspond to the zero base in the instructions. The basic problem here is that there is no way for the program to know which situation occurs, without spending time reading the Delila instructions. So the user must specify. (This may be automated in the future.) The second line of each entry is the coordinate number which appears on the left column of the aligned listing. 5. Column number to read from avalues file (integer), followed by the field width and number of decimal places to write the values to the list and clist. 6. edgecontrol edgeleft, edgeright, edgelow, edgehigh: edgecontrol is a single character that controls how the bounding box of the figure is handled. If it is 'p' then the bounding box will be the page parameters defined in constants inside the program (llx, lly, urx, ury). Otherwise, there are four real numbers that define the edges around the clist in cm. To allow a clist to be imbedded into another figure, its size must be defined in PostScript (with %%BoundingBox). By setting these four numbers, the edges are defined. 7. map control: A series of values: * mapcontrol: If the first character on the line is a 'C', then the color map file will be written. If it is 'R' then the page will be set up so that the upper left corner is moved to the lower left corner and the image is rotated 90 degrees counter clockwise. This has the effect of making the image in "landscape" mode. * fontsize (integer): The character height in points (there are 72 points/inch, 2.54 cm/inch). Typical value for alist: 15. 8. deltaXcm deltaYcm scaleimage: image positioning controls * deltaXcm: The amount to move the image in X (cm). * deltaYcm: The amount to move the image in Y (cm). * scaleimage: the scaling factor. The image will be shifted on the printed page. X is positive to the right and Y is positive up the page. Generally one would use positive values for X and negative values of Y since the image should otherwise fit snugly in the upper left corner of the page. The scaling is performed after movement from the lower left hand corner of the image as one would read it. If the image has been put in "landscape" mode the delta-shifts are given in the new coordinate system. This allows one to switch between "landscape" and regular "portrait" mode without changing the parameters, and it allows one to think in terms of a normally held page. 9. headercontrol: the first character on the line determines whether the header description is written to list and clist. If the character is 'h' it is written, otherwise not. Headers can also be removed from the clist by deleting lines containing the word "NOHEADER". In Unix this is done by: grep -v clist NOHEADER > clist.noheader With 'h' the numbar (bar of vertically written numbers) is included above the sequence, but if the character is '0' (zero) the numbar is not written. This allows one to use the list file to extract column data easily, otherwise it is not recommended. namebook: names of genes or transcripts from this book appear in the list. If namebook is empty, then only the items specified in alistp are given. namelist: if this file is not empty, then it should contain a simple list of names to give to each sequence listed. These are placed to the left of the alist and may contain anything one wants. The number of columns used is determined by the longest line in the file. avalues: Aligned list values. A file containing values to list for each of the sequences. If the file is not empty, the values appear to the right of the sequences. The first line of the file is expected to begin with "* " followed by the title of the values. All other lines that begin with "*" are ignored. The program uses the data column of avalues as defined in the alistp parameter file. list: the aligned listing clist: the aligned listing, in PostScript color. Paging is ALWAYS done to this file, using the page parameter. However, it can be removed by deleting all lines with the word "REMOVE" on them. This is easily done in Unix with: grep -v clist REMOVE colors: colors defining the bases, see makelogo for definition. output: messages to the user description Alist creates an aligned listing of a sets of sequences. The pieces in the book are aligned according to the instructions in file inst, and listed in the list file. Each piece is identified, and a bar of numbers (called a 'numbar') that are read vertically defines the locations of bases around the aligning point. example To generate an example input set using namebook, start with a set of instructions that name genes and get them (as 'get from gene beginning -0 to gene beginning +2;'). Produce namebook. Check for genes that are reversed relative to the piece (use hist and alist without instructions), and correct the delila instructions. To convert these instructions to absolute form, use program search with 'd f -54321 t +12345 q atg gtg ttg' on namebook. Now convert -54321 and +12345 to the range of interest (beware of absolute locations with the same numbers). Finally, generate the book using delila. (Someday this process will be simpler.) Here are some search instructions (file: sea): * instructions for the input file of the search program d q #gtt ~ = q (The blanks at the beginning of each line protect from the compiler detecting the # on the first line, and should be removed to try this example.) When these are given to search along with the book 'exobk': cp ex0bk book search < sea The inst file is: title "95/01/24 21:12:11 search 6.05"; (@ * 86/12/12 13:06:31, 84/05/05 21:12:50, ex0: example @) default numbering piece; default numbering 1; default out-of-range reduce-range; default coordinate zero; (@ typed pattern: "#gtt" @) organism ecoli; chromosome ecoli; piece lac; get from 43 -100 to 43 +100 direction +; (@ the complementary search string is now: "aa#c" @) (@ typed pattern: "aa#c" @) piece lac; get from 35 +100 to 35 -100 direction -; get from 42 +100 to 42 -100 direction -; (The '*' of comments was converted to '@' so that this page could be a comment in the alist source code.) Note the "default coordinate zero" which was inserted by hand. When these instructions are run through delila (using ex0bk as the library) and then given to alist with parameters alistp: -10 10 From and To pl display control p: piece&coordinate of zero base; l: long name n no paging i f: first base, i: inst, b: book alignment 6 4 1 avalues: column, output width, output decimals alistp: parameters for alist 5.54 and heigher An example list file is: alist 6.05, aligned listing of book: * 95/01/24 22:43:43, 95/01/24 19:36:00, 95/01/24 21:12:11 search 6.05 piece names from: * 95/01/24 22:43:43, 95/01/24 19:36:00, 95/01/24 21:12:11 search 6.05 The book is from: 0 to 20 This alignment is from: -30 to 20 --------------------- +++++++++++ 322222222221111111111--------- +++++++++11111111112 098765432109876543210987654321012345678901234567890 ................................................... lac 0 1 gtgaaaccagtaacgttatac lac 0 2 gtataacgttactggtttcac lac 0 3 gtataacgttactggtttcac documentation delman.use.aligned.books see also {program that produces the book: } delila.p {search program to help locate sites:} search.p {example inst:} spliceA.in {example book:} spliceA.bk {example aligned listing parameter file:} alistp {example colors file:} colors {To learn about page printer boundaries, go to} http://www.lecb.ncifcrf.gov/~toms/postscript.html#tricks author Thomas D. Schneider bugs If you use relative instructions, then alist will bomb. Ie, do not use instructions of the form: get from gene beginning - 5 to gene beginning +5; There is also an unsolved bug in alist: When the pieces and instructions are not 'just right', alist will produce listings that are thousands of characters wide... The reason for this is not completely clear, but it is related to attempting to extend the from-to range of an aligned book, and perhaps to incorrect responses of delila when attempting to 'reduce' a piece beginning or ending that is off the end of a fragment of a circular piece. The code now contains traps that halt the program when wide listings would have been generated. This bug may have been solved. Alist cannot align a sequence if the alignment point is outside the sequence. Note: it is possible to use the 'i' mode when "default coordinate zero" has been set, but this can lead to confusing output. There is no simple mechanism to prevent this in DelilaI. [1995 Dec 7] The namebook mechanism is currently broken for the clist. technical notes The variable 'nametype' defines the kind of name picked up in namebook. The constant 'pagelength' defines the length of the page in the list. The constant 'topofpage' defines the top of the page in cm in the clist. There are 4 constants that tell the program the printer page boundaries: The following bounding box is for the Canon Color Laser Copier 1150. defaultllx = 7.10999; default for llx, lower left x defaultlly = 7.01995; default for lly, lower left y defaulturx = 588.15; default for urx, upper right x defaultury = 784.98; default for ury, upper right y These should be set for your printer. To see how this is done, go to the link given in the See Also. Alternatively, you can use the edgecontrol parameter. As of version 5.96, alist can sense that a parameter file (alistp) is out of date and it will automatically upgrade the file. For this reason the parameter file is now listed as 'inout', meaning that it can be modified by this program. *) (* end module describe.alist *) (* begin module alist.const *) (* more constants *) pagelength = 59; (* the length of pages for the list, in lines *) headerlines = 10; (* the number of lines used by list first page header *) headerclines = 5; (* the number of lines used by clist page header *) maxnumberwidth = 7; (* the width of numbers in the list and clist *) columnmax = 20; (* maximum column name in characters *) (* bounding box definitions: *) (* The following bounding box is for the Canon Color Laser Copier 1150. *) defaultllx = 7.10999; (* default for llx, lower left x *) defaultlly = 7.01995; (* default for lly, lower left y *) defaulturx = 588.15; (* default for urx, upper right x *) defaultury = 784.98; (* default for ury, upper right y *) { (* The following bounding box is for the Canon Color Laser Copier 800S. *) defaultllx = 10.08; (* default for llx, lower left x *) defaultlly = 8.91; (* default for lly, lower left y *) defaulturx = 588.06; (* default for urx, upper right x *) defaultury = 779.85; (* default for ury, upper right y *) } { (* the following bounding box is for the Tektronix Inkjet Phaser 140 *) defaultllx = 14.4; (* default for llx, lower left x *) defaultlly = 28.9; (* default for lly, lower left y *) defaulturx = 596.8; (* default for urx, upper right x *) defaultury = 777.7; (* default for ury, upper right y *) } (* constants to control the edges *) deffontsize = 15; (* font size (height) in points (1/72 inch) *) defcolorlistcontrol = 'C'; (* normal display *) defcharacterratio = 0.60; (* default for the ratio of the rightward horizontal motion when a character is drawn to the font height. See lister.p for source and more information about this. *) topofpage = 27.0; (* top of page in cm *) defdeltaXcm = 1.0; (* default X shift in cm *) defdeltaYcm = -1.0; (* default Y shift in cm *) defscaleimage = 1.0; (* default scale of image *) (* end module alist.const *) (* LOCK begin module book.const *) (* constants needed for book manipulations *) dnamax = 300; (* length of dna arrays *) namelength = 100; (* maximum key name length *) linelength = 80; (* maximum line readable in book *) (* LOCK end module book.const version = 'delmod 6.88 98 Jul 10 tds/gds' *) (* PostScript constants *) pwid = 8; (* width in character places to print PostScript numbers *) pdec = 5; (* decimal places to print PostScript numbers *) pdecolor = 4; (* decimal places for color descriptions (5 WILL CAUSE NeWS 1.1 TO BOMB) *) (* begin module interact.const *) (* begin module string.const *) maxstring = 2000; (* the maximum string *) (* end module string.const version = 4.86; (@ of prgmod.p 2004 Sep 8 *) (* end module interact.const version = 7.72; {of delmod.p 2007 Jul 23} *) (* begin module filler.const *) fillermax = 50; (* the size of the filler array for a string *) (* end module filler.const version = 5.27; (@ of prgmod.p 2005 Aug 06 *) type (* begin module interact.type *) (* begin module string.type *) stringptr = ^string; (* pointer to a string *) string = record (* a string of characters *) letters: array[1..maxstring] of char; (* the letters in the string *) length: integer; (* the number of characters in the string *) current: integer; (* the letter we are working on *) next: stringptr; (* the next string in a series *) end; (* end module string.type version = 4.86; (@ of prgmod.p 2004 Sep 8 *) (* end module interact.type version = 7.72; {of delmod.p 2007 Jul 23} *) (* begin module filler.type *) (* the following is an array used to fill a string. it is convenient to have it much shorter than the maxstring, so that it is easy to fill the string using procedure fillstring. the user must declare the value of constant fillermax. *) filler = packed array[1..fillermax] of char; (* end module filler.type version = 5.27; (@ of prgmod.p 2005 Aug 06 *) (* begin module trigger.type *) trigger = record (* an object to be searched for *) seek: string; (* the characters looked for *) state: integer; (* how close to triggering we are *) skip: boolean; (* trigger not found- skip the line *) found: boolean (* the trigger was found *) end; (* end module trigger.type version = 5.27; (@ of prgmod.p 2005 Aug 06 *) (* begin module book.type *) (* types needed for book manipulations *) chset = set of 'a'..'z'; (* types defined in book definition *) alpha = packed array[1..namelength] of char; (* this is not alfa *) (* name is a left justified string with blanks following the characters *) name = record letters: alpha; length: 0..namelength (* zero means an unspecified structure *) end; lineptr = ^line; line = record (* a line of characters *) letters: packed array [1..linelength] of char; length: 0..linelength; next: lineptr end; direction = (plus, minus, dircomplement, dirhomologous); configuration = (linear, circular); state = (on, off); header = record (* header of key *) keynam: name; (* key name of structure *) fulnam: lineptr; (* full name of structure *) note: lineptr (* note key *) end; (* begin module base.type *) (* define the four nucleotide bases *) base = (a,c,g,t); (* end module base.type version = 7.72; {of delmod.p 2007 Jul 23} *) (* sequence types *) dnaptr = ^dnastring; dnarange = 0..dnamax; seq = packed array[1..dnamax] of base; dnastring = record part: seq; length: dnarange; next: dnaptr end; orgkey = record (* organism key *) hea: header; mapunit: lineptr (* genetic map units *) end; chrkey = record (* chromosome key *) hea: header; mapbeg: real; (* number of genetic map beginning *) mapend: real (* number of genetic map ending *) end; pieceptr = ^piece; piekey = record (* piece key *) hea: header; mapbeg: real; (* genetic map beginning *) coocon: configuration; (* configruation (circular/linear) *) coodir: direction; (* direction (+/-) relative to genetic map *) coobeg: integer; (* beginning nucleotide *) cooend: integer; (* ending nucleotide *) piecon: configuration; (* configruation (circular/linear) *) piedir: direction; (* direction (+/-) relative to coordinates *) piebeg: integer; (* beginning nucleotide *) pieend: integer; (* ending nucleotide *) end; piece = record key: piekey; dna: dnaptr end; reference = record pienam : name; (* name of piece referred to *) mapbeg : real; (* genetic map beginning *) refdir : direction; (* direction relative to coordinates *) refbeg : integer; (* beginning nucleotide *) refend : integer; (* ending nucleotide *) end; genkey = record (* gene key *) hea : header; ref : reference; end; trakey = record (* transcript key *) hea : header; ref : reference; end; markerptr = ^marker; markey = record (* marker key *) hea : header; ref : reference; sta : state; phenotype : lineptr; next : markerptr; end; marker = record key : markey; dna : dnaptr; end; (* end module book.type version = 7.72; {of delmod.p 2007 Jul 23} *) var inst, (* the delila instructions required by the align procedures *) book, (* the book to be aligned *) alistp, (* parameters to constrol the program *) namebook, (* a book from which to draw names of pieces listed *) namelist, (* a list of names *) avalues, (* values to list *) list, (* the resulting aligned listing *) clist, (* the resulting aligned listing, in color PostScript *) colors: (* colors PostScript *) text; (* variables used by the align routines: *) apiece: pieceptr; length, alignedbase: integer; fromparam, toparam: integer; fromdo, todo: integer; (* user defined range to use *) userrange: boolean; (* if true, the user defined range is used *) displaylevel: char; (* defines how much information to put on the display 'p' means put piece name and zero coordinate *) usefullname: char; (* defines whether to use the long name from the book 'l' means use it *) fullnamewidth: integer; (* length of the longest fullname in the book *) paging: char; (* defines whether to do pages. If 'n' no pages are done *) index: integer; (* aligned space index *) indexfill: integer; (* index for filling out the namelist *) cpagelength: integer; (* the length of pages for the clist, in lines. This used to be hardwired to 47, but now is computed from the bounding box information defaultlly and defaultury in startpostscript. *) linenumber: integer; (* line of the page we are on *) clinenumber: integer; (* line of the page we are on in color *) { headerlinenumber: integer; (* header length for list *) this is not used } (* the number of lines used by the first page header of clist: *) headerclinenumber: integer; pagenumber: integer; (* the page number *) cpagenumber: integer; (* the page number *) (* used by procedures maxname and printname for getocp *) org: orgkey; orgchange, orgopen: boolean; chr: chrkey; chrchange, chropen: boolean; pie: pieceptr; piechange, pieopen: boolean; nametype: char; (* the type of name to look for in namebook. it can be 'g', 't', or 'p'. *) namewidth: integer; (* the amount of space to allocate to names *) namelistwidth: integer; (* space to allocate for names in namelist *) numberwidth: integer; (* the width of numbers in the list and clist *) positionwidth: integer; (* the width of position numbers *) sequences: integer; (* the number of sequences in the book *) b: char; (* a base to print out *) column: integer; (* counts the column of the printout so that color PostScript won't have really huge lines *) alignmenttype: char; (* 'f' means alignment by First internal coordinate base, 'b' means alignment by Book, 'i' means alignment by Instructions *) cnamelist: char; (* a character for reading and writing namelist *) programname: name; (* the name of this program *) thedirection: char; (* the direction of the piece to report *) readvalues: boolean; (* whether to read values from file avalues *) columnname: array[1..columnmax] of char; (* column name *) columnlength: integer; (* current length of the columnname *) columntoread: integer; (* the column to read from avalues *) columnwid: integer; (* the character width of the avalues column to write *) columndec: integer; (* the decimal places of the avalues column to write *) columnvalue: real; (* a value from the column of avalues *) theline: integer; (* current line in the book *) parameterversion: real; (* parameter version number *) (* variables to control the postscript display *) llx: real; (* lower left x *) lly: real; (* lower left y *) urx: real; (* upper left x *) ury: real; (* upper left y *) edgecontrol: char; (* if 'p' then use page instead of edges *) edgeleft, edgeright, edgelow, edgehigh: real; (* edges around the clist *) blanks: integer; (* the number of blanks before the numbar *) displaywidth: integer; (* total width of display in characters *) cmfactor: real; (* convert from cm to points *) { not used: fontsizecm: real; (* font size in cm *) } fontsize: integer; (* font size in points (1/72 inch) *) colorlistcontrol: char; (* control map production *) mapcontrol: boolean; (* true if colorlistcontrol = 'C' or 'R' *) deltaXcm: real; (* amount to move the entire page in X *) deltaYcm: real; (* amount to move the entire page in Y *) scaleimage: real; (* amount to scale the entire page from upper left corner *) headercontrol: char; (* control the header, 'h' means produce the header *) (* begin module book.var *) (* ************************************************************************ *) (* global variables needed for book manipulations *) (* free storage: *) freeline: lineptr; (* unused lines *) freedna: dnaptr; (* unused dnas *) readnumber: boolean; (* whether to read a number from the notes, or to read in the notes *) number: integer; (* the number of the item just read *) numbered: boolean; (* true when the item just read is numbered *) skipunnum: boolean; (* a control variable to allow skipping of un-numbered items in the book *) (* ************************************************************************ *) (* end module book.var version = 7.72; {of delmod.p 2007 Jul 23} *) (* begin module crash *) procedure crash; (* Crash the program by trying to open a nonexistant file. This allows tracing by the dbx program. To use: insert call into the halt program or whereever a traceable stop is desired. *) var bogus: text; (* boghous internal file *) begin writeln(output,' program crash.'); reset(bogus); end; (* end module crash version = 7.72; {of delmod.p 2007 Jul 23} *) (* begin module halt *) procedure halt; (* stop the program. the procedure performs a goto to the end of the program. you must have a label: label 1; declared, and also the end of the program must have this label: 1: end. examples are in the module libraries. this is the only goto in the delila system. *) begin writeln(output,' program halt.'); goto 1 end; (* end module halt version = 7.72; {of delmod.p 2007 Jul 23} *) (* begin module copyaline *) procedure copyaline(var fin, fout: text); (* copy a line from file fin to file fout *) begin (* copyaline *) while not eoln(fin) do begin fout^ := fin^; put(fout); get(fin) end; readln(fin); writeln(fout); end; (* copyaline *) (* end module copyaline version = 7.72; {of delmod.p 2007 Jul 23} *) (* begin module copynoreturn *) procedure copynoreturn(var fin, fout: text); (* copy a line from file fin to file fout but don't put a carriage return *) begin (* copynoreturn *) while not eoln(fin) do begin fout^ := fin^; put(fout); get(fin) end; readln(fin); (* writeln(fout); *) end; (* copynoreturn *) (* end module copynoreturn *) (* begin module copytocomma *) procedure copytocomma(var fin, fout: text); (* copy a line from file fin to file fout only up to a comma and don't put a carriage return if found *) var done: boolean; (* done copying *) begin (* copynoreturn *) done := false; while not done do begin if eoln(fin) then begin done := true; readln(fin); end else begin if fin^ = ',' then done := true; fout^ := fin^; put(fout); get(fin) end end; end; (* copytocomma *) (* end module copytocomma *) (* begin module splitbooktitle *) procedure splitbooktitle(var book, list: text); (* copy the title of the book to the list, but split the title line up: * 2000/06/21 00:40:04, 1999/05/11 16:29:30, OxyR version = 2.12 of inst.oxyr 2000 June 21 *) begin reset(book); copytocomma(book, list); copytocomma(book, list); writeln(list); write(list,' '); copyaline(book, list); end; (* end module splitbooktitle *) (******************************************************************************) (******************************************************************************) (******************************************************************************) (* begin module package.trigger *) (* ************************************************************************ *) (* begin module clearstring *) (* These modules clear strings in various ways *) (* ---- *) procedure emptystring(var ribbon: string); (* empty the contents of the string but do NOT remove the pointer. This is useful for clearing one string within a linked list of them. *) var index: integer; (* to the ribbon *) begin (* clearstring *) with ribbon do begin for index := 1 to maxstring do letters[index] := ' '; length := 0; current := 0; end end; (* emptystring *) (* ---- *) procedure clearstring(var ribbon: string); (* empty the string and remove the pointer *) begin (* clearstring *) with ribbon do begin emptystring(ribbon); next := nil; end end; (* clearstring *) (* ---- *) procedure initializestring(var ribbon: string); (* start the string with a nil pointer. This routine should be called before doing linked list work. This allows the standard string routines to clear the string without killing the pointer. This is now deprecated, do not use it since clearstring still clears the next pointer. *) begin (* initializestring *) writeln(output,'remove initializestring routine!'); writeln(output,'replace it with clearstring routine!'); halt; (* to force deprecation *) clearstring(ribbon); ribbon.next := nil; end; (* initializestring *) (* end module clearstring version = 5.27; (@ of prgmod.p 2005 Aug 06 *) (* begin module writestring *) procedure writestring(var tofile: text; var s: string); (* write the string s to file tofile, no writeln *) var i: integer; (* index to s *) begin (* writestring *) with s do for i := 1 to length do write(tofile, letters[i]) end; (* writestring *) (* end module writestring version = 5.27; (@ of prgmod.p 2005 Aug 06 *) (* begin module filler.fillstring *) procedure fillstring(var s: string; a: filler); (* this procedure makes it reasonably easy to fill the string s with characters. one calls the procedure as: *) (* 1 2 3 4 5 *) (* 12345678901234567890123456789012345678901234567890 *) (* fillstring(s, 'this-is-the-string '); the two comments make it easy to line the characters up. also, for this example, it was assumed that the length of filler as defined by the constant fillermax was 50. *) var length: integer; (* of the string without trailing blanks *) index: integer; (* of s *) begin (* fillstring *) clearstring(s); length := fillermax; while (length > 1) and (a[length] = ' ') do length := pred(length); if (length = 1) and (a[length] = ' ') then begin writeln(output, 'fillstring: the string is empty'); halt end; for index := 1 to length do s.letters[index] := a[index]; s.length := length; s.current := 1 end; (* fillstring *) (* end module filler.fillstring version = 5.27; (@ of prgmod.p 2005 Aug 06 *) (* begin module filler.filltrigger *) procedure filltrigger(var t: trigger; a: filler); (* fill the trigger t *) begin (* filltrigger *) fillstring(t.seek,a) end; (* fillstring *) (* end module filler.filltrigger version = 5.27; (@ of prgmod.p 2005 Aug 06 *) (* begin module trigger.proc *) (* this module allows one to scan a series of characters, as from an array or a file, and to "trigger" or detect a simple string in the series. the advantage of the trigger is that several triggers can "observe" a stream of characters at once, each looking for a different thing. some other modules required: interact.const, interact.type *) procedure resettrigger(var t: trigger); (* reset the trigger to ground state *) begin (* resettrigger *) with t do begin state := 0; skip := false; found := false end end; (* resettrigger *) procedure testfortrigger(ch: char; var t: trigger); (* look at the character ch. if it is part of the trigger (at the current trigger state), then the trigger state goes higher. if it is not part of the trigger then the trigger state is reset, skip is true and one should skip onward to find the trigger. if the trigger is found, found is true. 1996 Sep 12: Bug found! In the case of a trigger "ab", the program used to miss it for situations like "aab". This was because at the first a it would step up. Then it would see the second a and recognize that was not part of ab. It would fail to realize that it could be the start of a new one. The code now accounts for that possibility. *) begin (* testfortrigger *) with t do begin state := succ(state); { writestring(list,seek); writeln(list,'testfortrigger seek.letters[',state:1,']:', seek.letters[state],' ch:',ch); } if seek.letters[state] = ch then begin skip := false; if state = seek.length then found := true else found := false end else begin (* it failed. But wait! It could be the beginning of a NEW trigger string! *) if seek.letters[1] = ch then begin state := 1; skip := false; found := false end else begin (* reset trigger *) state := 0; skip := true; found := false end end end end; (* testfortrigger *) (* end module trigger.proc version = 5.27; (@ of prgmod.p 2005 Aug 06 *) (* begin module skipblanks *) (* 2003 July 31: tab is considered a blank character *) function isblank(c: char): boolean; (* is the character c blank or tab? *) const tab = 9; (* tab character *) begin isblank := (c = ' ') or (ord(c) = tab) end; procedure skipblanks(var thefile: text); (* skip over blanks until a non-blank, or end of line, is found *) begin while isblank(thefile^) and not eoln(thefile) do get(thefile); end; procedure skipnonblanks(var thefile: text); (* skip over nonblanks until a blank, or end of line, is found *) begin while (not isblank(thefile^)) and not eoln(thefile) do get(thefile); end; procedure skipcolumn(var thefile: text); (* skip over a data column *) begin skipblanks(thefile); skipnonblanks(thefile) end; (* end module skipblanks version = 5.27; (@ of prgmod.p 2005 Aug 06 *) (* ************************************************************************ *) (* end module package.trigger version = 5.27; (@ of prgmod.p 2005 Aug 06 *) (******************************************************************************) (******************************************************************************) (******************************************************************************) (* begin module package.align *) (* ************************************************************************ *) (* begin module package.getpiece *) (* ************************************************************************ *) (* begin module package.brpiece *) (* ************************************************************************ *) (* begin module book.basis *) (* procedures needed for book manipulations *) (* get procedures should be used for all linked lists of records *) procedure getline(var l: lineptr); (* obtain a line from the free line list or by making a new one *) begin if freeline<>nil then begin l:=freeline; freeline:=freeline^.next end else new(l); l^.length:=0; l^.next:=nil end; procedure getdna(var l: dnaptr); begin if freedna<>nil then begin l:=freedna; freedna:=freedna^.next end else new(l); l^.length:=0; l^.next:=nil end; (* clear procedures should be called each time the records are no longer needed failure to do this may result in a stack overflow. *) procedure clearline(var l: lineptr); (* return a line to the free line list *) var lptr: lineptr; begin if l<>nil then begin lptr:=l; l:=l^.next; lptr^.next:=freeline; freeline:=lptr end end; procedure writeline(var afile: text; l: lineptr; carriagereturn: boolean); (* write a line to a file, with carriage return if carriagereturn is true. *) var index: integer; (* index to characters in l *) begin with l^ do begin for index := 1 to length do write(afile, letters[index]); end; if carriagereturn then writeln(afile); end; procedure showfreedna; (* show the freedna list *) var counter: integer; (* count of freedna list *) l: dnaptr; (* pointer into freedna list *) begin l := freedna; counter := 0; while l <> nil do begin counter := succ(counter); write(output,counter:1); write(output, ', length = ',l^.length:1); { This is illegal according to gpc because one cannot write a pointer to a text file. It can be unearthed for debugging. write(output, ', pointer id: ',l:1); } writeln(output); l := l^.next end; end; procedure cleardna(var l: dnaptr); (* clear the dna strutures to the free list *) var lptr: dnaptr; begin if l<>nil then begin lptr:=l; l:=l^.next; lptr^.next:=freedna; freedna:=lptr end end; procedure clearheader(var h: header); (* clear the header h (remove lines to free storage) *) begin with h do begin clearline(fulnam); while note<>nil do clearline(note) end end; procedure clearpiece(var p: pieceptr); (* clear the dna of the piece *) begin while p^.dna<>nil do cleardna(p^.dna); clearheader(p^.key.hea) end; function chartobase(ch:char):base; (* convert a character into a base *) begin case ch of 'a': chartobase:=a; 'c': chartobase:=c; 'g': chartobase:=g; 't': chartobase:=t end end; function basetochar(ba:base):char; (* convert a base into a character *) begin case ba of a: basetochar:='a'; c: basetochar:='c'; g: basetochar:='g'; t: basetochar:='t'; end end; function complement(ba:base):base; (* take the complement of ba *) begin case ba of a: complement:=t; c: complement:=g; g: complement:=c; t: complement:=a; end end; function chomplement(b: char): char; (* create the character complement of base b. I must be getting hungry! *) begin chomplement := basetochar(complement(chartobase(b))); end; function pietoint(p: integer; pie: pieceptr): integer; (* p is a coordinate on the piece. we want to transform p into a number from 1 to n: an internal coordinate system for easy manipulation of piece coordinates *) (* Note: the dirhomologous and dircomplement are treated as plus and minus directions, which MIGHT NOT BE RIGHT! *) var i: integer; (* an intermediate value *) begin with pie^.key do begin case piedir of dirhomologous, plus: if p>=piebeg then i:=p-piebeg+1 else i:=(p-coobeg)+(cooend-piebeg)+2; dircomplement, minus: if p<=piebeg then i:=piebeg-p+1 else i:=(cooend-p)+(piebeg-coobeg)+2 end; pietoint:=i end end; function inttopie(i: integer; pie: pieceptr):integer; (* i is in the range 1 to some maximum. it is an internal coordinate system for the program. we want to do a coordinate transformation to obtain a value in the range of the piece called pie: i=1 corresponds to piebeg and i=its maximum corresponds to pieend *) (* Note: the dirhomologous and dircomplement are treated as plus and minus directions, which MIGHT NOT BE RIGHT! *) var p: integer; (* an intermediate value *) begin with pie^.key do begin case piedir of dirhomologous, plus: begin p:=piebeg+(i-1); if p>cooend then if coocon=circular then p:=p-(cooend-coobeg+1) end; dircomplement, minus: begin p:=piebeg-(i-1); if p '*' then begin writeln(output,' procedure skipstar: bad book'); writeln(output,' "*" expected as first character on the line, but "', thefile^,'" was found'); halt end; get(thefile); (* skip the star *) if thefile^ <> ' ' then begin writeln(output,' procedure skipstar: bad book'); writeln(output,' "* " expected on a line but "*', thefile^,'" was found'); halt end; get(thefile) (* skip the blank *) end end; (* skipstar *) (* end module book.skipstar version = 7.72; {of delmod.p 2007 Jul 23} *) (* begin module book.brreanum *) procedure brreanum(var thefile: text; var theline: integer; var reanum: real); (* read a real number from the file *) begin skipstar(thefile); readln(thefile,reanum); theline := succ(theline) end; (* end module book.brreanum version = 7.72; {of delmod.p 2007 Jul 23} *) (* begin module book.brnumber *) procedure brnumber(var thefile: text; var theline: integer; var num: integer); (* read a number from the file *) begin skipstar(thefile); readln(thefile,num); theline := succ(theline) end; (* end module book.brnumber version = 7.72; {of delmod.p 2007 Jul 23} *) (* begin module book.brname *) procedure brname(var thefile: text; var theline: integer; var nam: name); (* read a name from the file *) var i: integer; (* an index to the name *) c: char; (* a character read *) begin (* brname *) skipstar(thefile); with nam do begin length:=0; repeat length:=succ(length); read(thefile,c); letters[length] := c until (eoln(thefile)) or (length>=namelength) or (letters[length]=' '); if letters[length]=' ' then length:=length-1; if length ',linelength:1,' characters'); writeln(output,'* Only ',linelength:1,' characters read from book'); writeln(output,'***********************************************'); end; l^.length:=i; l^.next:=nil; readln(thefile); theline := succ(theline) end; (* end module book.brline version = 7.72; {of delmod.p 2007 Jul 23} *) (* begin module book.brdirect *) procedure brdirect(var thefile: text; var theline: integer; var direct: direction); (* read a direction *) var ch: char; begin skipstar(thefile); readln(thefile,ch); theline := succ(theline); if ch='+' then direct:=plus else direct:=minus end; (* end module book.brdirect version = 7.72; {of delmod.p 2007 Jul 23} *) (* begin module book.brconfig *) procedure brconfig(var thefile: text; var theline: integer; var config: configuration); (* read a configuration *) var ch: char; begin skipstar(thefile); readln(thefile,ch); theline := succ(theline); if ch='l' then config:=linear else config:=circular end; (* end module book.brconfig version = 7.72; {of delmod.p 2007 Jul 23} *) (* begin module book.brnotenumber *) procedure brnotenumber(var thefile: text; var theline: integer; var note: lineptr); (* book note reading to obtain the number of the object. the procedure returns the value of the number as a global. (this is not such a good practice, but we are stuck with it for now.) *) begin (* brnotenumber *) note:=nil; numbered := false; number := 0; (* force number to zero if there is no number at all *) (* the next character is n or * depending on whether there are notes *) if thefile^ = 'n' then begin readln(thefile); theline := succ(theline); if thefile^ <> 'n' then begin skipstar(thefile); if not eoln(thefile) then begin if thefile^ = '#' then begin numbered := true; get(thefile); (* move past the number symbol *) read(thefile,number); end end; repeat readln(thefile); theline := succ(theline) until thefile^ = 'n'; readln(thefile); theline := succ(theline) end else begin readln(thefile); theline := succ(theline) end end end; (* brnotenumber *) (* end module book.brnotenumber version = 7.72; {of delmod.p 2007 Jul 23} *) (* begin module book.brnote *) procedure brnote(var thefile: text; var theline: integer; var note: lineptr); (* read note key *) var newnote: lineptr; (* the new note *) previousnote: lineptr; (* the last line of the notes *) begin (* brnote *) note:=nil; if thefile^ = 'n' then begin (* enter note *) readln(thefile); theline := succ(theline); if thefile^ <> 'n' then begin (* abort null note (n/n) *) getline(note); newnote:=note; while thefile^ <> 'n' do begin (* wait until end of note *) brline(thefile,theline,newnote); previousnote:=newnote; (* get next note *) getline(newnote^.next); newnote:=newnote^.next; end; (* last note was not used, so: *) clearline(newnote); previousnote^.next:=nil; readln(thefile); theline := succ(theline); end else begin readln(thefile); theline := succ(theline); end; end end; (* brnote *) (* end module book.brnote version = 7.72; {of delmod.p 2007 Jul 23} *) (* begin module book.brheader *) procedure brheader(var thefile: text; var theline: integer; var hea: header); (* read the header of a key. *) begin with hea do begin readln(thefile); (* move past the object name - new definition 1999 Mar 13 *) theline := succ(theline); {bbb} (* read key name *) brname(thefile,theline,keynam); (* read full name *) getline(fulnam); brline(thefile,theline,fulnam); (* read note key *) if readnumber then brnotenumber(thefile,theline,note) else brnote(thefile,theline,note) end end; (* end module book.brheader version = 7.72; {of delmod.p 2007 Jul 23} *) (* begin module book.copyheader *) procedure copyheader(fromhea: header; var tohea: header); (* copy the header fromhea into tohea. Note that the linked objects are NOT copied, but merely pointed to. *) begin tohea.keynam.letters := fromhea.keynam.letters; tohea.keynam.length := fromhea.keynam.length; tohea.note := fromhea.note; tohea.fulnam := fromhea.fulnam; end; (* end module book.copyheader version = 7.72; {of delmod.p 2007 Jul 23} *) (* begin module book.brpiekey *) procedure brpiekey(var thefile: text; var theline: integer; var pie: piekey); (* read piece key, track the line number *) begin with pie do begin brheader(thefile,theline,hea); brreanum(thefile,theline,mapbeg); brconfig(thefile,theline,coocon); brdirect(thefile,theline,coodir); brnumber(thefile,theline,coobeg); brnumber(thefile,theline,cooend); brconfig(thefile,theline,piecon); brdirect(thefile,theline,piedir); brnumber(thefile,theline,piebeg); brnumber(thefile,theline,pieend); end end; (* end module book.brpiekey version = 7.72; {of delmod.p 2007 Jul 23} *) (* begin module book.brdna *) procedure brdna(var thefile: text; var theline: integer; var dna: dnaptr); (* read in dna from thefile, track the line *) (* note: if the dna were circularized, by linking the last dnastring to the first, then the cleardna routine could not clear properly, and would loop forever... there is no reason to do that, since a simple mod function will allow one to access the circle. *) var ch: char; workdna: dnaptr; begin getdna(dna); workdna:=dna; ch:=getto(thefile,theline,['d']); readln(thefile); theline := succ(theline); read(thefile,ch); (* skipstar *) while (ch = '*') do begin read(thefile,ch); (* skip blank *) repeat read(thefile,ch); if ch in ['a','c','g','t'] then begin if workdna^.length=dnamax then begin getdna(workdna^.next); workdna:=workdna^.next end; workdna^.length:=succ(workdna^.length); workdna^.part[workdna^.length]:=chartobase(ch) end until eoln(thefile); readln(thefile); (* go to next line *) theline := succ(theline); read(thefile,ch); (* ch is either '*' or 'd' *) end; readln(thefile); (* read past the d *) theline := succ(theline); end; (* end module book.brdna version = 7.72; {of delmod.p 2007 Jul 23} *) (* begin module book.brpiece *) procedure brpiece(var thefile: text; var theline: integer; var pie: pieceptr); (* read in a piece, change theline to reflect the lines traversed *) begin { readln(thefile); (* move past the word 'piece' - new definition 1999 Mar 13 *) theline := succ(theline); (* BUG: was below! *) bbb} brpiekey(thefile,theline,pie^.key); if numbered or (not skipunnum) then brdna(thefile,theline,pie^.dna); readln(thefile); (* move past the word 'piece' - new definition 1999 Mar 13 *) theline := succ(theline); end; (* end module book.brpiece version = 7.72; {of delmod.p 2007 Jul 23} *) (* begin module book.brinit *) procedure brinit(var book: text; var theline: integer); (* check that the book is ok to read, and set up the global variables for br routines *) begin (* brinit *) (* halt if the book is bad (first word is 'halt') or the first character is not * *) reset(book); if not eof(book) then begin (* check for the date line *) if book^ <> '*' then begin if book^ <> 'h' then writeln(output, ' this is not the first line of a book:') else writeln(output, ' bad book:'); write(output, ' '); while not (eoln(book) or eof(book)) do begin write(output, book^); get(book) end; writeln(output); halt end end else begin writeln(output, ' book is empty'); halt end; (* initialize free storage *) freeline:=nil; freedna:=nil; readnumber:=true; (* usually we read in numbers for items *) number:=0; (* arbitrary value *) numbered:=false; (* the piece has no number (none yet read in) *) skipunnum:=false; theline := 1; end; (* brinit *) (* end module book.brinit version = 7.72; {of delmod.p 2007 Jul 23} *) (* ************************************************************************ *) (* end module package.brpiece version = 7.72; {of delmod.p 2007 Jul 23} *) (* begin module book.getpiece *) procedure getpiece(var thefile: text; var theline: integer; var pie: pieceptr); (* move to and read in the next piece in the book *) var ch: char; begin ch:=getto(thefile,theline,['p']); (* get to the next p(iece) in the book *) if ch<>' ' then begin brpiece(thefile,theline,pie); { 1999 june 2: removed this: ch:=getto(thefile,theline,['p']); (* read to end of p *) } { bbb - now done in brpiece readln(thefile); (* read past piece *) theline := succ(theline); } end else clearpiece(pie); end; (* end module book.getpiece version = 7.72; {of delmod.p 2007 Jul 23} *) (* ************************************************************************ *) (* end module package.getpiece version = 7.72; {of delmod.p 2007 Jul 23} *) (* begin module findblank *) procedure findblank(var afile: text); (* read a file to find the next blank character *) var ch: char; begin repeat read(afile,ch) until ch = ' ' end; (* end module findblank version = 7.72; {of delmod.p 2007 Jul 23} *) (* begin module findnonblank *) procedure findnonblank(var afile: text; var ch: char); (* find the next non blank character in a file, return it in ch. *) begin ch:=' '; while (not eof(afile)) and (ch = ' ') do begin read(afile,ch); if eoln(afile) then readln(afile) end end; (* end module findnonblank version = 7.72; {of delmod.p 2007 Jul 23} *) (* begin module align.align *) procedure align(var inst, book: text; var theline: integer; var pie: pieceptr; var length, alignedbase: integer); (* documentation on align is in module info.align and delman.use.aligned.books. 1996 Sep 12: The routine now uses the trigger functions found in prgmod. The bug in the oldalign routine (that it misses the end of comments that end in a series of asterisks) has been fixed. It now checks that the piece corresponds to the book. *) const maximumrange = 10000; (* if the alignment point is more than this distance from the piece ends, the program halts in an attempt to catch the alignment bug... 1991 Jan 11 It appears that the rewrite of the code has removed the bug, but the check will be kept. *) semicolon = ';'; (* end of delila instruction *) var ch: char; (* a character in inst *) p: integer; (* index to a piece name *) p1: integer; (* another index to a piece name *) done: boolean; (* done finding an aligning get *) thebase: integer; (* the base read in *) indefault: boolean; (* true when within a default statement. These can contain the word 'piece', which must be ignored. *) gettrigger: trigger; (* trigger to find 'get' *) defaulttrigger: trigger; (* trigger to find 'default' *) nametrigger: trigger; (* trigger to find 'name' *) piecetrigger: trigger; (* trigger to find 'piece' *) settrigger: trigger; (* trigger to find 'set' *) begincomment: trigger; (* trigger to find '(-*' (ignore the dash!) *) endcomment: trigger; (* trigger to find '*-)' (ignore the dash!) *) begincurly: trigger; (* trigger to find comments: '{' *) endcurly: trigger; (* trigger to find comments: '}' *) quote1trigger: trigger; (* trigger to find single quote ' *) quote2trigger: trigger; (* trigger to find double quote " *) dotteddone: boolean; (* a dot '.' has been found in the name - ignore the rest of the name - for comparisons with mutations. *) { procedure rd(var f: text; var ch: char); (* read ch from f allowing inspection of the result *) begin read(f,ch); write(output,ch); write(list,ch); write(output,'<',ch,'>'); end; procedure rdln(var f: text); (* readln f allowing inspection of the result *) begin readln(f); writeln(output); writeln(list); end; } procedure skipcomment(var f: text); (* skip an entire comment *) var comment: boolean; (* true means we are inside a comment *) begin (* skip to end of comment *) resettrigger(endcomment); comment := true; while comment do begin if eof(f) then begin writeln(output,'A comment does not end!'); halt end; if eoln(f) then readln(f) { rdln(f) } else begin {write(output,'<'); rd(f,ch); write(output,'>');} read(f,ch); testfortrigger(ch, endcomment); if endcomment.found then comment := false; end end end; procedure skipcurly(var f: text); (* skip an entire comment made by {}*) var comment: boolean; (* true means we are inside a comment *) begin (* skip to end of comment *) resettrigger(endcurly); comment := true; while comment do begin if eof(f) then begin writeln(output,'A comment does not end!'); halt end; if eoln(f) then readln(f) { rdln(f) } else begin {write(output,'<'); rd(f,ch); write(output,'>');} read(f,ch); testfortrigger(ch, endcurly); if endcurly.found then comment := false; end end end; procedure skipquote(quote: trigger); (* skip an entire quote of either the ' or " persuasion *) var kind: char; (* the kind of quote, ' or " *) begin kind := quote.seek.letters[1]; {writeln(output,'skipquote ',kind);} repeat findnonblank(inst,ch); (* get to the quote *) until (ch = kind) or eof(inst); if ch <> kind then begin writeln(output,'end of quote starting with ',kind,' not found'); halt; end; end; begin filltrigger(defaulttrigger,'default'); filltrigger(gettrigger,'get '); filltrigger(nametrigger,'name '); filltrigger(piecetrigger,'piece '); filltrigger(settrigger,'set '); filltrigger(begincomment,'(* '); filltrigger(endcomment,'*) '); filltrigger(begincurly,'{ '); filltrigger(endcurly,'} '); filltrigger(quote1trigger,''' '); filltrigger(quote2trigger,'" '); resettrigger(defaulttrigger); resettrigger(gettrigger); resettrigger(nametrigger); resettrigger(piecetrigger); resettrigger(settrigger); resettrigger(begincomment); resettrigger(begincurly); resettrigger(quote1trigger); resettrigger(quote2trigger); indefault := false; if not eof(book) then begin (* if there is still more to the book ... *) getpiece(book,theline,pie); (* read in the piece *) if not eof(book) then begin (* if we found a piece ... *) length:=pietoint(pie^.key.pieend,pie); (* calculate piece length *) (* now find in inst the next occurance of 'get' *) done := false; while not done do begin if eof(inst) then begin (* no instructions? *) alignedbase := 1; (* simply align by the first base *) done := true end else begin if eoln(inst) then readln(inst) {then rdln(inst)} else begin {rd(inst,ch);} read(inst,ch); testfortrigger(ch, begincomment); testfortrigger(ch, begincurly); if begincomment.found or begincurly.found then begin if ch = '*' then begin skipcomment(inst); resettrigger(begincomment); end else begin resettrigger(begincurly); skipcurly(inst); end end else begin (* we are not inside a comment *) testfortrigger(ch, gettrigger); if gettrigger.found then begin findnonblank(inst,ch); (* get to "from" *) findblank(inst); (* get past "from" *) read(inst,thebase); (* read in the alignedbase *) {writeln(output);writeln(output,'thebase = ',thebase:1);} alignedbase:=pietoint(thebase,pie); {writeln(output,'alignedbase=',alignedbase:1);} done := true end; testfortrigger(ch, quote1trigger); if quote1trigger.found then begin skipquote(quote1trigger); end; testfortrigger(ch, quote2trigger); if quote2trigger.found then begin skipquote(quote2trigger); end; testfortrigger(ch, defaulttrigger); if defaulttrigger.found then begin indefault := true; resettrigger(defaulttrigger) end; if ch = semicolon then indefault := false; testfortrigger(ch, settrigger); if settrigger.found then begin indefault := true; resettrigger(settrigger) end; if ch = semicolon then indefault := false; (* check that piece names are correct *) testfortrigger(ch, piecetrigger); if not indefault then if piecetrigger.found then begin skipblanks(inst); (* get to name *) with pie^.key.hea.keynam do begin { for p := 1 to length do begin } (* 2007 Jun 22: replace loop with while so that we can drop out when dotted names are detected. *) p := 1; dotteddone := false; while not dotteddone do begin if eoln(inst) then dotteddone := true else begin read(inst,ch); (* ignore names after a dot *) { if ch = '.' then writeln(output,'inst dotteddone'); } if ch = '.' then dotteddone := true; if letters[p] = '.' then dotteddone := true; { if ch = '.' then writeln(output,'book dotteddone'); writeln(output,'BUBBa ch = ',ch,' ',p:1); } {zzz} if (letters[p] <> ch) and (not dotteddone) and (ch <> ';') then begin writeln(output, 'The piece name in the book: '); writeln(output,letters:length); writeln(output,'does not match', ' the inst file piece name:'); (* write the letters that matched: *) for p1 := 1 to p-1 do write(output,letters[p1]); (* write the offending letter: *) write(output, ch); (* get the rest of the name and show it: *) done := eoln(inst); while not done do begin done := eoln(inst); if not done then begin read(inst,ch); if (ch = ' ') or (ch = ';') then done := true; if not done then write(output,ch); end; end; writeln(output); (* mark the first letter that does not match: *) for p1 := 1 to p-1 do write(output,' '); write(output,'^'); writeln(output); halt end; p := p + 1; if p > length then dotteddone := true; end; end end; end; end end end end; if (alignedbase <= -maximumrange) or (alignedbase > length + maximumrange) then begin writeln(output,' In procedure align:'); writeln(output,' read in base was ',thebase:1); writeln(output,' in internal coordinates: ',alignedbase:1); writeln(output,' maximum range was ',maximumrange:1); writeln(output,' piece length was ',length:1); with pie^.key.hea.keynam do writeln(output,' piece name: ',letters:length); writeln(output,' piece number: ',number:1); writeln(output,' aligned base is too far away... see the code'); halt end end end end; (* end module align.align version = 7.72; {of delmod.p 2007 Jul 23} *) (* ************************************************************************ *) (* end module package.align version = 7.72; {of delmod.p 2007 Jul 23} *) (* begin module align.maxminalignment *) procedure maxminalignment(var inst, book: text; var theline: integer; var fromparam, toparam: integer; alignmenttype: char); (* prescan the book to find the range over which the pieces of the book are spread, relative to the aligned base. the procedure uses the same variables that align does (so it can call align itself), and it returns the range in fromparam and toparam. alignmenttype: 'f' means alignment by First internal coordinate base, 'b' means alignment by Book, 'i' means alignment by Instructions. *) const maximumrange = 500; (* the maximum size aligned piece; this will presumably catch the alignment bug *) var distance: integer; (* a distance to the aligned base *) pie: pieceptr; length, alignedbase: integer; begin new(pie); (* set an initial range for the two bounds *) fromparam:=+maxint; toparam:=-maxint; reset(book); reset(inst); while not eof(book) do begin case alignmenttype of 'i': align(inst,book,theline,pie,length,alignedbase); 'b','f': begin getpiece(book,theline,pie); (* read in the piece *) length := piecelength(pie); end; end; if not eof(book) then begin case alignmenttype of 'f': begin (* force alignment on first base *) alignedbase := 0; fromparam := 1; distance:=length-alignedbase; if toparam < distance then toparam:=distance; end; 'i': begin (* use the alignedbase from the book *) distance:=1-alignedbase; if fromparam > distance then fromparam:=distance; distance:=length-alignedbase; if toparam < distance then toparam:=distance; end; 'b': begin (* use the internal book *) alignedbase := pietoint(0, pie); distance:=1-alignedbase; if fromparam > distance then fromparam:=distance; distance:=length-alignedbase; if toparam < distance then toparam:=distance; end; end; clearpiece(pie) end end; if toparam - fromparam > maximumrange then begin writeln(output,' in procedure maxminalignment:'); writeln(output,' alignedbase = ',alignedbase:1); writeln(output,' fromparameter = ',fromparam:1); writeln(output,' toparameter = ',toparam:1); writeln(output,' this exceeds the maximum range allowed (', maximumrange:1,')'); writeln(output,' see notes in the procedure. '); halt (* notes: if you desired this range, increase 'maximumrange'. otherwise, this may indicate a bug - either: 1) locate the bug (and tell tom schneider, please...) 2) reduce the size of the fragments, from one or the other end until the bombing is stopped. *) end; (* make the book readable again *) reset(book); reset(inst); dispose(pie) end; (* end module align.maxminalignment version = 7.72; {of delmod.p 2007 Jul 23} *) (* begin module align.withinalignment *) function withinalignment(alignedposition, alignedbase, length: integer) :boolean; (* this function tells one if an aligned position, relative to an aligned base in a piece of some length is within the piece. *) var p: integer;(* the position on the piece *) begin p := alignedposition + alignedbase; withinalignment := (p>0) and (p<=length) end; (* end module align.withinalignment version = 7.72; {of delmod.p 2007 Jul 23} *) (* begin module book.getbase *) function getbase(position: integer; pie: pieceptr):base; (* Get a base from the position (internal coordinates) of the piece. Protection is made against positions outside the piece. In the case of circles it would be convenient to wrap around when requests are off the end. So the routine will do a modular wrap for positions outside the range 1 to the length. This is a new feature as of 2000 March 22. *) var workdna: dnaptr; (* pointer to the dna part of pie *) p: integer; (* current count of bases into the workdna *) spot: integer; (* the last base of the dna part *) thelength: integer; (* the length of the piece *) begin { writeln(output,'NEW getbase: position=',position:1,'^^^^^^^^^^^^^^^^^^^^'); } (* handle cases of position out of range by circular wrapping *) thelength := piecelength(pie); while position < 1 do position := position + thelength; while position > thelength do position := position - thelength; workdna:=pie^.dna; p:=workdna^.length; while position > p do begin { writeln(output,' workdna^.length=',workdna^.length:1); } workdna := workdna^.next; if workdna = nil then begin writeln(output,'error in function getbase!'); halt end; p := p + workdna^.length; end; { writeln(output,'p=',p:1); } if workdna = nil then begin writeln(output,'error in getbase: request off end of piece'); halt end else begin spot := workdna^.length - (p-position); { writeln(output,'spot=',spot:1); showdnasegment(output,workdna, spot); } if (spot <= 0) then begin writeln(output,'error in getbase, spot (= ',spot:1, ') must be positive'); halt end; if (spot > workdna^.length) then begin writeln(output,'error in getbase, spot (=',spot:1, ') must be less than length (=',workdna^.length:1,')'); halt end; { writeln(output,'base = ', workdna^.part[spot]); } getbase:=workdna^.part[spot] end end; (* end module book.getbase version = 7.72; {of delmod.p 2007 Jul 23} *) (* begin module package.numbar *) (* ************************************************************************ *) (* begin module numberdigit *) function numberdigit(number, logplace:integer): char; (* return the digit at the place value ('logplace') position of number. example: numberdigit(13625, 3) = 3 numberdigit(13625, 4) = 1 2000 July 30 'myabsolute' replaced 'absolute', which is apparently a keyword for GPC. The name is kept to keep the code looking similar to its origin. *) var place: integer; (* the exponent of logplace *) count: integer; (* used to make place *) myabsolute: integer; (* the absolute value of number *) acharacter: char; (* the character to be returned *) procedure digit; (* extract a digit at the place position *) var tenplace: integer; (* ten times place *) z: integer; (* an intermediate value *) d: integer; (* the digit extracted *) begin (* digit *) tenplace:=10*place; z:=myabsolute-((myabsolute div tenplace)*tenplace); if place = 1 then d:=z else d:= z div place; case d of 0: acharacter:='0'; 1: acharacter:='1'; 2: acharacter:='2'; 3: acharacter:='3'; 4: acharacter:='4'; 5: acharacter:='5'; 6: acharacter:='6'; 7: acharacter:='7'; 8: acharacter:='8'; 9: acharacter:='9'; end end; (* digit *) procedure sign; (* put a negative sign out or a positive sign *) begin (* sign *) if number <0 then acharacter:='-' else acharacter:='+' end; (* sign *) begin (* numberdigit *) place:=1; for count:=1 to logplace do place:=10*place; if number=0 then begin if place=1 then acharacter:='0' else acharacter:=' ' end else begin myabsolute:=abs(number); if myabsolute < (place div 10) then acharacter:=' ' else if myabsolute >= place then digit else sign end; numberdigit:=acharacter end; (* numberdigit *) (* end module numberdigit version = 5.27; (@ of prgmod.p 2005 Aug 06 *) (* begin module numbersize *) function numbersize(n: integer):integer; (* calculate amount of space to be reserved for the integer n *) const ln10 = 2.30259; (* natural log of 10 - for conversion to log base 10 *) epsilon = 0.00001; (* a small number to correct log base 10 errors *) var size: integer; (* intermediate result *) begin (* numbersize *) if n = 0 then numbersize:=1 else begin size:=trunc(ln(abs(n))/ln10 + epsilon) + 1; (* the 1 is for the last digit *) (* the epsilon assures that we do not lose a place due to roundoff. eg, sometimes log base 10 of 10 would be 0.9999 instead of 1, and we would not do it right... note: this will fail for very large numbers on the order of 1/epsilon. *) if n < 0 then size := succ(size); (* account for minus sign *) numbersize := size; end end; (* numbersize *) (* end module numbersize version = 5.27; (@ of prgmod.p 2005 Aug 06 *) (* begin module numberbar *) function firstlastmax(firstnumber, lastnumber: integer): integer; (* compute the sizes of firstnumber and lastnumber (including + or - sign) and then determine which number is larger *) var firstlines: integer; (* number of lines needed for firstumber *) lastlines: integer; (* number of lines needed for lastnumber *) begin firstlines := numbersize(firstnumber); if firstnumber > 0 then firstlines := firstlines + 1; (* add one more for + sign *) lastlines := numbersize(lastnumber); if lastnumber > 0 then lastlines := lastlines + 1; (* add one more for + sign *) if firstlines > lastlines then firstlastmax := firstlines else firstlastmax := lastlines; end; procedure numberbar(var afile: text; spaces, firstnumber, lastnumber: integer; var linesused: integer); (* write a bar of numbers to a file, with several spaces before. the number of lines used is returned *) var logplace: integer; (* the log of the digit being looked at *) number: integer; (* the current number being written *) spacecount: integer; (* count of spaces *) begin { 2000 June 24: This code was not sufficient to deal with the sign correctly. The numbersize routine now does *not* give the + sign (which makes it useful for other purposes) so we have to account for it here now. if abs(firstnumber) > abs(lastnumber) then linesused:= numbersize(firstnumber) else linesused:= numbersize(lastnumber); } linesused := firstlastmax(firstnumber, lastnumber); { writeln(output,'numberbar says linesused = ',linesused:1); for logplace:=linesused-1 downto 0 do begin 1999 July 15: this is changed to linesused since numbersize now accounts for the sign: for logplace := linesused downto 0 do begin 2000 June 24: back to the old code ... } for logplace := linesused-1 downto 0 do begin for spacecount:=1 to spaces do write(afile,' '); for number:=firstnumber to lastnumber do write(afile,numberdigit(number,logplace)); writeln(afile) end end; (* end module numberbar version = 5.27; (@ of prgmod.p 2005 Aug 06 *) (* ************************************************************************ *) (* end module package.numbar version = 5.27; (@ of prgmod.p 2005 Aug 06 *) (* begin module align.getpositions *) procedure getpositions(var inst, book: text; var positionwidth, numberwidth: integer; var count: integer; (* number of pieces found *) alignmenttype: char); (* prescan the book to find the width of position numbers and the number of fragments. Convert these to the minimum widths necessary to print them. NOTE: although one can count the number of pieces, this is not necessarily the number to use for numberwidth! The reason is that numbers are controlled by Delila. So one wants the max of the global 'number'. *) var ab: integer; (* maximum of the aligned base coordinates *) coordinate: integer; (* an alignment coordinate *) maxnumber: integer; (* maximum of global 'number' *) negatives: boolean; (* the maximum number was negative *) pie: pieceptr; (* a piece of DNA *) length, alignedbase: integer; (* the length of the pie and its aligned base *) begin new(pie); brinit(book,theline); reset(inst); ab := 0; count := 0; maxnumber := 0; negatives := false; while not eof(book) do begin case alignmenttype of 'i': align(inst,book,theline,pie,length,alignedbase); 'b','f': getpiece(book,theline,pie); (* read in the piece *) end; if not eof(book) then begin count := count + 1; if abs(number) > maxnumber then begin maxnumber := abs(number); if number < 0 then negatives := true else negatives := false end; case alignmenttype of 'f': coordinate := inttopie(1,pie); 'b','i': coordinate := inttopie(alignedbase,pie); end; if abs(coordinate) > abs(ab) then ab := coordinate; clearpiece(pie) end end; (* make the book readable again *) reset(book); reset(inst); dispose(pie); (* Finally, determine the number of characters necessary for printing the number. Numbersize allows for a sign. A Delila instruction could give negative numbers to a piece. Otherwise, we remove the extra blank with the if statement below. *) numberwidth := numbersize(maxnumber); { this is old, not correct now that numbersize does this properly: if not negatives then numberwidth := numberwidth - 1; } (* writeln(output,'count=',count:1); writeln(output,'numberwidth=',numberwidth:1); *) if ab = 0 then positionwidth := 1 else positionwidth := numbersize(ab); end; (* end module align.getpositions *) procedure noheader(var a: text); begin writeln(a,' % NOHEADER FOR PACKAGING INTO ANOTHER FIGURE'); end; procedure removeit(var a: text); begin writeln(a,' % REMOVE FOR PACKAGING INTO ANOTHER FIGURE'); end; (* begin module pnumberbar *) procedure pnumberbar(var afile: text; spaces, firstnumber, lastnumber: integer; var linesused: integer); (* write a bar of numbers to a file, with several spaces before. The number of lines used is returned. In this variant of numberbar lines are to be written in postscript. By doing things this way, upgrades to numberbar automatically get are applied to this routine. (I got caught on one upgrade that did not propagate to this routine!) *) var internal: text; (* internal file for creating the result *) begin rewrite(internal); numberbar(internal, spaces, firstnumber, lastnumber, linesused); reset(internal); while not eof(internal) do begin write(afile,'('); while not eoln(internal) do begin afile^ := internal^; put(afile); get(internal) end; readln(internal); writeln(afile,') sn'); end; end; (* end module pnumberbar *) (* begin module book.name *) procedure clearname(var n: name); (* clear the name n *) var i: integer; (* index to piece name *) begin n.length := 0; for i := 1 to namelength do n.letters[i] := ' '; end; procedure writename(var f: text; n: name); (* write the name n to file f *) var i: integer; (* index to piece name *) begin for i := 1 to n.length do write(f,n.letters[i]); end; procedure copyname(a: name; var b: name); (* copy name a to name b *) var i: integer; (* index to piece name *) begin for i := 1 to a.length do b.letters[i] := a.letters[i]; b.length := a.length; end; function equalname(a,b: name): boolean; (* is name a equal to name b? *) var i: integer; (* index to piece name *) same: boolean; (* temporary variable to hold the answer *) begin same := true; (* what optimism!! *) if b.length = a.length then begin i := 1; while same and (i <= a.length) do begin same := (b.letters[i] = a.letters[i]); i := succ(i); end end else same := false; equalname := same; end; (* end module book.name version = 7.72; {of delmod.p 2007 Jul 23} *) (* begin module book.brorgkey *) procedure brorgkey(var thefile: text; var theline: integer; var org: orgkey); (* read organism key *) begin with org do begin {bbb} brheader(thefile,theline,hea); getline(mapunit); brline(thefile,theline,mapunit); end end; (* end module book.brorgkey version = 7.72; {of delmod.p 2007 Jul 23} *) (* begin module book.brchrkey *) procedure brchrkey(var thefile: text; var theline: integer; var chr: chrkey); (* read chromosome key *) begin with chr do begin {bbb} brheader(thefile,theline,hea); brreanum(thefile,theline,mapbeg); brreanum(thefile,theline,mapend); end end; (* end module book.brchrkey version = 7.72; {of delmod.p 2007 Jul 23} *) (* begin module book.getocp *) procedure getocp(var thefile: text; var theline: integer; var org: orgkey; var orgchange, orgopen: boolean; var chr: chrkey; var chrchange, chropen: boolean; var pie: pieceptr; var piechange, pieopen: boolean); (* Get the next piece and its organism and chromosome keys. The three change variables indicate whether or not a new organism, chromosome or piece name was found. If a piece is not found, then pieopen will be false. orgopen, chropen and pieopen are used by getocp to tell when it has entered an organism, chromosome or piece. All booleans should be set to false initially. There should be one triplet for each book read. It is important to initialize ALL variables, including pie: orgchange := false; orgopen := false; chrchange := false; chropen := false; piechange := false; pieopen := false; pie := nil; theline := 0; 1999 June 2 The book reading routines now treat data objects more precisely. Rather than test for eof, the endo of book occurs when pieopen is returned as false. A book reading loop now looks like this: repeat getocp(book, theline, org, orgchange, orgopen, chr, chrchange, chropen, pie, piechange, pieopen); writeln(output,'pieopen: ',pieopen); if pieopen then begin writeln(output,'piece at line: ',theline:1); end; until not pieopen; *) var ch: char; newchr: chrkey; neworg: orgkey; newpie: pieceptr; begin ch:='a'; while not (ch in [' ','p']) do begin ch:=getto(thefile,theline,['o','c','p']); if ch <> ' ' then begin case ch of 'o': if orgopen then begin readln(thefile); (* move past the word 'organism' - new definition 1999 Mar 13 *) orgopen:=false (* close organism *) end else begin brorgkey(thefile,theline,neworg); if (neworg.hea.keynam.letters <> org.hea.keynam.letters) and (neworg.hea.keynam.length <> org.hea.keynam.length) then begin { writeln(output,'--------orgchanged!'); write (output,'--------old org:"', org.hea.keynam.letters); writeln(output, '" ', org.hea.keynam.length:1); write (output,'--------new org:"',neworg.hea.keynam.letters); writeln(output, '" ',neworg.hea.keynam.length:1); } (*ccc*) orgchange:=true; copyheader(neworg.hea,org.hea); (* move the mapunit over to the org! *) org.mapunit := neworg.mapunit; clearline(neworg.mapunit); end else orgchange:=false; orgopen:=true; end; 'c': if chropen then begin readln(thefile); (* move past the word 'chromosome' - new definition 1999 Mar 13 *) chropen:=false (* close chromosome *) end else begin brchrkey(thefile,theline,newchr); if (newchr.hea.keynam.letters <> chr.hea.keynam.letters) and (newchr.hea.keynam.length <> chr.hea.keynam.length) then begin { writeln(output,'--------chrchanged!'); write (output,'--------old chr:"', chr.hea.keynam.letters); writeln(output, '" ', chr.hea.keynam.length:1); write (output,'--------new chr:"',newchr.hea.keynam.letters); writeln(output, '" ',newchr.hea.keynam.length:1); } chrchange:=true; copyheader(newchr.hea,chr.hea); (* move the map range over to the chr! *) chr.mapbeg := newchr.mapbeg; chr.mapend := newchr.mapend; end else chrchange:=false; chropen:=true; end; 'p': if pieopen then begin pieopen:=false; (* close last piece *) ch:='a' (* prevent falling out of the loop *) end else begin new(newpie); brpiece(thefile,theline,newpie); if pie = nil then piechange := true else begin if (newpie^.key.hea.keynam.letters <> pie^.key.hea.keynam.letters) and (newpie^.key.hea.keynam.length <> pie^.key.hea.keynam.length) then begin piechange:=true; end else piechange:=false; end; pieopen:=true; (* we always have to switch over to the new piece, because although the name may be the same, the DNA sequence could be different. That is, the book may contain two pieces with the same name, and we want to be sure to search the new one, not the old one. *) if pie <> nil then begin clearpiece(pie); (* save the links *) dispose(pie); (* close up shop *) end; pie := newpie; end end end else begin pieopen := false end end end; (* origin: search version = 6.39 *) (* end module book.getocp version = 7.72; {of delmod.p 2007 Jul 23} *) (* begin module emptyfile *) function emptyfile(var afile: text): boolean; (* This function is a replacement for eof() to get around a bug in the GPC compiler. The GPC bug is that end-of-file, as provided by eof(), is false when a file is empty. The way to get around it is to count characters in the file to determine if it is empty. Fortunately this is fast for large files because the count stops once a single or a few characters are seen. A single character will not do unfortunately because GPC will give an '*' for an empty file. So the test is for having a certain number (boundary) or fewer characters. This is not great, but it only means that the file must be at least 'boundary' characters long. Furthermore, since the file is being READ, the emptyfile test CANNOT be used in a loop to test for eof! Use emptyfile only to check that the file is empty. Use eof inside loops IF the file is not empty. Dr. Thomas D. Schneider National Institutes of Health National Cancer Institute Center for Cancer Research Nanobiology Program Molecular Information Theory Group Frederick, Maryland 21702-1201 toms@ncifcrf.gov permanent email: toms@alum.mit.edu (use only if first address fails) http://www.ccrnp.ncifcrf.gov/~toms/ *) const debugging = false; boundary = 2; (* one needs at least this many characters for a file to be considered 'non empty'. *) var lines: integer; (* count of lines in the file *) chars: integer; (* count of characters in the file *) ch: char; (* a character in the file *) begin reset(afile); lines := 0; chars := 0; while (not eof(afile)) and (chars < boundary) do begin if eoln(afile) then begin lines := succ(lines); readln(afile); end else begin read(afile,ch); if debugging then begin writeln(output,'ord(ch) = ',ord(ch)); writeln(output,' ch = ', ch ); end; chars := succ(chars); end end; if chars < boundary then emptyfile := true else emptyfile := false; if debugging then begin writeln(output,'lines = ',lines:1); writeln(output,'chars = ',chars:1); if chars < boundary then writeln(output,' empty (file)') else writeln(output,'NOT empty (file)'); end; reset(afile); (* put the file back at the start!! *) end; (* end module emptyfile *) (* begin module getname *) procedure getname(var namebook: text; theline: integer; nametype: char; var typefound: char; var aname: name; var org: orgkey; var orgchange, orgopen: boolean; var chr: chrkey; var chrchange, chropen: boolean; var pie: pieceptr; var piechange, pieopen: boolean); (* get to the next name in name book, looking for an organism or the type defined by nametype. org/chr/pie and the change and open booleans keep track of where we are in the book. They are used by getocp. *) (* getname should eventually be replaced by a procedure that reads instructions rather than a book. ... 2000 May 9 probably not. *) begin { writeln(output,'getname: searching for nametype=',nametype); } if eof(namebook) then typefound:=' ' else begin typefound:='.'; repeat getocp(book, theline, org, orgchange, orgopen, chr, chrchange, chropen, pie, piechange, pieopen); if pieopen then begin typefound := 'p'; aname := pie^.key.hea.keynam; end else if chropen then begin typefound := 'c'; aname := chr.hea.keynam; end else if orgopen then begin typefound := 'o'; aname := org.hea.keynam; end else begin typefound := ' '; end until typefound in [' ', 'o', nametype]; end { ;writeln(output,'getname: typefound = "',typefound,'"'); ;write(output,'getname: obtained: "'); ;writename(output,aname); ;writeln(output,'" -----------------------'); ;writeln(output); } end; (* end module getname *) (* begin module maxname *) procedure maxname(var namebook: text; theline: integer; nametype: char; var namewidth: integer; var tofile: text; var linenumber: integer; var org: orgkey; var orgchange, orgopen: boolean; var chr: chrkey; var chrchange, chropen: boolean; var pie: pieceptr; var piechange, pieopen: boolean); (* figure out the maximum length needed to be allocated to print the names, print book information in tofile, and increment linenumber of tofile *) var aname: name; (* a name *) typefound: char; (* what thing was found *) begin reset(namebook); namewidth := 0; if not emptyfile(namebook) then begin brinit(namebook, theline); orgchange := false; chrchange := false; piechange := false; orgopen := false; chropen := false; pieopen := false; if headercontrol = 'h' then begin case nametype of 'g': write(tofile, 'gene'); 't': write(tofile, 'transcript'); 'p': write(tofile, 'piece'); end; writeln(tofile, ' names from:'); splitbooktitle(namebook, tofile); theline := theline + 1; linenumber := linenumber + 2; end; typefound:='.'; orgopen:=false; while typefound <> ' ' do begin getname(namebook, theline, nametype, typefound, aname, org, orgchange, orgopen, chr, chrchange, chropen, pie, piechange, pieopen); if not(typefound in ['o', ' ']) then (* is g t or p *) if typefound = nametype then if aname.length > namewidth then namewidth:=aname.length end end; end; (* end module maxname *) (* begin module maxfullnamewidth *) procedure maxfullnamewidth(var book: text; theline: integer; var fullnamewidth: integer); (* figure out the maximum length needed to be allocated to print long names *) var fullname: lineptr; (* line containing fullname *) typefound: char; (* what thing was found *) begin reset(book); fullnamewidth:=0; {writeln(output,'maxfullnamewidth');} while not eof(book) do begin {writeln(output,'@',book^);} typefound := getto(book,theline,['p']); if typefound = 'p' then begin readln(book); (* skip name *) readln(book); (* get full name *) getline(fullname); brline(book,theline,fullname); { write(output,'maxfullnamewidth name: "'); for index := 1 to fullname^.length do write(output, fullname^.letters[index]); writeln(output,'"'); } if fullname^.length > fullnamewidth then fullnamewidth:=fullname^.length; { writeln(output,'fullnamewidth:', fullnamewidth:1); } clearline(fullname); (* locate end of piece *) typefound := getto(book,theline,['p']); if typefound <> 'p' then begin writeln(output,'book structure is bad:', ' a piece does not have an end'); halt; end; readln(book); theline := succ(theline); end end; { writeln(output,'ending fullnamewidth:', fullnamewidth:1); } {uuu BUBBA} { writeln(output, '************** fullnamewidth = ', fullnamewidth:5,' ******'); } end; (* end module maxfullnamewidth *) (* begin module printname *) procedure printname(var namebook: text; theline: integer; nametype: char; namewidth: integer; var tofile, ctofile: text; var org: orgkey; var orgchange, orgopen: boolean; var chr: chrkey; var chrchange, chropen: boolean; var pie: pieceptr; var piechange, pieopen: boolean; var linenumber, clinenumber: integer); (* print names of items in the book from namebook to tofile. organism is always printed, and one other type specified by nametype (one of 'g', 't', 'p') is printed namewidth wide. orgopen is used to keep track of the organism. *) var aname: name; (* the name found *) typefound: char; (* the type of the name *) index: integer; (* for printing the name *) begin repeat getname(namebook, theline, nametype, typefound, aname, org, orgchange, orgopen, chr, chrchange, chropen, pie, piechange, pieopen); if typefound <> ' ' then begin case typefound of 'o': begin writeln(tofile); writeln(tofile, ' organism ', aname.letters); writeln(ctofile); writeln(ctofile, ' organism ', aname.letters); linenumber:=linenumber+2; (* two lines written *) clinenumber:=clinenumber+2 (* two lines written *) end; 'g', 't', 'p': begin write(tofile, ' '); write(ctofile, ' '); for index:=1 to namewidth do write(tofile, aname.letters[index]); for index:=1 to namewidth do write(ctofile, aname.letters[index]) end end end until typefound in [' ', nametype] end; (* end module printname *) (* begin module maxnamelist *) procedure maxnamelist(var namelist: text; var namelistwidth: integer); (* determine the length of the longest line in namelist. *) var c: char; (* a character for reading namelist *) currentmax: integer; (* the current maximum *) count: integer; (* count of characters in the file. This is to get around a problem in GPC: GPC does not give file EOF when the file has been reset! *) begin reset(namelist); count := 0; if not emptyfile(namelist) then begin currentmax := 1; (* allow 1 space at the start *) while not eof(namelist) do begin if eoln(namelist) then begin readln(namelist); if currentmax > namelistwidth then namelistwidth := currentmax; currentmax := 1; (* allow 1 space at the start *) end else begin read(namelist, c); count := count + 1; currentmax := succ(currentmax); end; end; end else namelistwidth := 0; (* writeln(output,' namelistwidth = ',namelistwidth:1); writeln(output,' count = ',count:1); *) end; (* end module maxnamelist *) (* begin module makelogo.protectcharacter *) procedure protectcharacter(c: char; var protectioncharacter: char; var needed: boolean); (* In PostScript, special characters must be protected against. This routine looks at a character c and returns a protection character if it is needed. The parenthesis is used in PostScript to indicate the bounds of a string, while the percent is the comment character. The backslash also needs protection, since it is the escape to indicate that the next character is part of the string. *) begin if c in ['(',')','%','\'] then begin protectioncharacter := '\'; needed := true end else begin protectioncharacter := ' '; needed := false end end; (* end module makelogo.protectcharacter version = 5.27; (@ of prgmod.p 2005 Aug 06 *) (* begin module makelogo.protectpostscript *) procedure protectpostscript(var afile: text; c: char); (* Special characters must be protected against! Put out a protective backslash for character c which would otherwise destroy the PostScript interpreter. The parenthesis is used in PostScript to indicate the bounds of a string, while the percent is the comment character. The backslash also needs protection, since it is the escape to indicate that the next character is part of the string. *) var needed: boolean; (* is protection needed? *) protectionchar: char; (* is protection needed? *) begin protectcharacter(c, protectionchar, needed); if needed then write(afile,protectionchar); end; (* end module makelogo.protectpostscript version = 5.27; (@ of prgmod.p 2005 Aug 06 *) procedure figureblanks(var blanks: integer); (* figure out how many blanks to use in the display for numberbar *) begin (* the blank before the sequences and the name list width *) blanks := 1 + namelistwidth; if not emptyfile(namebook) then blanks:=blanks + (namewidth+1); {BUBBA uuu blanks := 0; this removes the extra blanks for the number } (* 1 blank for orientation character + 1 more for spacing = +2 *) if displaylevel = 'p' then blanks := blanks + namewidth + (positionwidth+1) +2; if displaylevel = 'c' then blanks := blanks + (positionwidth+1) +2; if numbered then blanks := blanks + (numberwidth+1); if usefullname = 'l' (* note the extra blank for padding *) then blanks := blanks + fullnamewidth + 1; {writeln(output,'blanks = ',blanks:1);} end; (* begin module alist.startpostscript *) procedure startpostscript(var a, colors: text; programname: name; deltaXcm, deltaYcm, scaleimage: real; defaultllx: real; (* lower left x *) defaultlly: real; (* lower left y *) defaulturx: real; (* upper left x *) defaultury: real; (* upper left y *) fromdo, todo: integer; (* range of sequences *) sequences: integer; (* number of sequences in book *) cmfactor: real; (* convert from cm to points *) (* the number of lines used by the first page header of clist: *) headerclinenumber: integer); (* start writing postscript for color text lines to file a, using the colors file for color definitions. programname is the name of this program. deltaXcm and deltaYcm determine how much to move the image on the page. scaleimage is the scaling factor from the upper left hand corner. the llx, lly, urx, ury parameters determine where the image resides. lines is the number of lines to account for vertically. headercontrol controls the header at the start of the file. *) const debugging = false; (* debugging the postscript *) var i: integer; (* index to the name n *) red,green,blue: real; (* colors *) symbol: char; (* one of the bases *) currentdisplay: real; (* current display width in points *) requireddisplay: real; (* required display width in points *) pointcorrection: real; (* requireddisplay - currentdisplay *) lines: integer; (* maximum number of lines on a page, based on number of sequences *) numbarlines: integer; (* lines used by number *) actuallines: integer; (* actual lines required for the page *) begin (* compute available page length in lines. *) cpagelength := trunc((defaultury-defaultlly)/(fontsize)); (* we are sure to do the sequences! *) actuallines := sequences; (* account for the numbar if we are going to do one *) if headercontrol <> '0' then begin numbarlines := firstlastmax(fromdo, todo); (* the extra +1 is the dots between the numbar and the sequence *) actuallines := actuallines + numbarlines + 1; end; (* account for the non-number header lines if we are going to do them *) if (headercontrol = 'h') then actuallines := actuallines + headerclinenumber; { writeln(output,'START>>>> clinenumber = ',clinenumber:1); writeln(output,'>>>> clinenumber = ',clinenumber:1); writeln(output,' actual headerclinenumber = ',headerclinenumber:1); writeln(output,' const headerclines = ',headerclines:1); } (* At this point the actual number of header lines written out is is 0 since nothing has been written to clist yet. But we need to compute things from how many there will be later. To do that, the constant headerclines is used. Just after writing the header the program checks that headerclinenumber does indeed match headerclines. If they don't it is a program error and the counting of headerclinenumber should be made to match the actual number of clist header lines produced. *) if actuallines < cpagelength then lines := actuallines else lines := cpagelength; {zboundingbox} if debugging then begin writeln(output,'-------------------'); writeln(output,'fromdo = ',fromdo :1); writeln(output,' todo = ', todo :1); writeln(output,'numbersize(fromdo) = ',numbersize(fromdo) :1); writeln(output,'numbersize( todo) = ',numbersize( todo) :1); writeln(output,'numbarlines = ',numbarlines:1); writeln(output,'sequences = ',sequences :1); writeln(output,'headerlines = ',headerlines:1); writeln(output,'actuallines = ',actuallines:1); writeln(output,'cpagelength = ',cpagelength:1); writeln(output,'lines = ',lines :1); writeln(output,'-------------------'); writeln(output,'cmfactor = ',cmfactor:1:1); writeln(output,'defaultury = ',defaultury :1:1); writeln(output,'defaultlly = ',defaultlly :1:1); writeln(output,'(defaultury-defaultlly)/cmfactor = ',(defaultury-defaultlly)/cmfactor:1:1); writeln(output,'(defaultury-defaultlly) = ',(defaultury-defaultlly):1:1); writeln(output,'-------------------'); writeln(output); end; {writeln(output,'edgecontrol = "',edgecontrol,'"');} if edgecontrol <> 'p' then begin (* figure out the total display width *) figureblanks(blanks); { writeln(output,'***************************************'); writeln(output,'before startpostscript data available: '); writeln(output,'blanks = ',blanks:3); writeln(output,'fromdo = ',fromdo:3); writeln(output,'todo = ',todo:3); writeln(output,'columnlength = ',columnlength:3); writeln(output,'columnwid = ',columnwid:3); } (* the blanks are the part to the left of the numbar fromdo and todo are the range of the sequence 3 is the space around the display (about 1.5 char on both sides) columnlength is the length of the columnname *) displaywidth := blanks + (todo - fromdo +1) + 3; if columnlength > columnwid then displaywidth := displaywidth + columnlength else displaywidth := displaywidth + columnwid; { writeln(output,'displaywidth = ', displaywidth:3); writeln(output,'***************************************'); } { writeln(output,'BEFORE urx = ', urx:1:3); writeln(output,'fontsize = ', fontsize:1:3); } if colorlistcontrol <> 'R' then begin (* portrait *) llx := defaultllx; (* lower left x *) lly := defaultlly; (* lower left y *) urx := defaulturx; (* upper left x *) ury := defaultury; (* upper left y *) currentdisplay := urx - llx; (* at least make sure that the whole display can be seen *) requireddisplay := fontsize * defcharacterratio * displaywidth; pointcorrection := requireddisplay - currentdisplay; { writeln(output,'requireddisplay = ', requireddisplay:1:1); writeln(output,'currentdisplay = ', currentdisplay :1:1); writeln(output,'pointcorrection = ', pointcorrection:1:1); writeln(output,'AFTER urx = ', urx:1:3); } urx := urx + pointcorrection; llx := llx - edgeleft * cmfactor; lly := lly - edgelow * cmfactor; urx := urx + edgeright * cmfactor; ury := ury + edgehigh * cmfactor; (* remove extra blanks from the bottom of the bounding box *) lly := lly + ((cpagelength - lines) * (fontsize)); {zboundingbox} { writeln(output,'(cpagelength - lines) = ',(cpagelength - lines):1); writeln(output,'fontsize = ',fontsize:1); } end else begin (* rotation to landscape *) llx := defaultlly; (* lower left x NOTE SWITCH!! *) lly := defaultllx; (* lower left y NOTE SWITCH!! *) urx := defaultury; (* upper left x NOTE SWITCH!! *) ury := defaulturx; (* upper left y NOTE SWITCH!! *) currentdisplay := ury - lly; (* at least make sure that the whole display can be seen *) requireddisplay := fontsize * defcharacterratio * displaywidth; pointcorrection := requireddisplay - currentdisplay; { writeln(output,'requireddisplay = ', requireddisplay:1:1); writeln(output,'currentdisplay = ', currentdisplay :1:1); writeln(output,'pointcorrection = ', pointcorrection:1:1); } ury := ury + pointcorrection; llx := llx - edgehigh * cmfactor; lly := lly - edgeleft * cmfactor; urx := urx + edgelow * cmfactor; ury := ury + edgeright * cmfactor; (* remove extra blanks from the bottom of the bounding box *) urx := urx - ((cpagelength - lines) * (fontsize)); {zboundingbox} end; (* move the display around to always match: *) llx := llx + deltaXcm * cmfactor; lly := lly + deltaYcm * cmfactor; urx := urx + deltaXcm * cmfactor; ury := ury + deltaYcm * cmfactor; end; writeln(a,'%!PS-Adobe-2.0 EPSF-2.0'); write (a,'%%Title: '); for i := 1 to programname.length do write(a,programname.letters[i]); writeln(a,' ',version:4:2); writeln(a,'%%Creator: Tom Schneider'); writeln(a,'%%BoundingBox:', ' ',round(llx):5, ' ',round(lly):5, ' ',round(urx):5, ' ',round(ury):5); writeln(a,'%%Pages: 1'); writeln(a,'%%DocumentFonts:'); writeln(a,'%%EndComments'); writeln(a,'%%EndProlog'); writeln(a,'/cmfactor 72 2.54 div def % defines points -> centimeters'); writeln(a,'/cm { cmfactor mul} def % defines centimeters'); writeln(a,'/llx ',llx:5:1,' def'); writeln(a,'/lly ',lly:5:1,' def'); writeln(a,'/urx ',urx:5:1,' def'); writeln(a,'/ury ',ury:5:1,' def'); writeln(a,'/edgecontrol (',edgecontrol,') def'); writeln(a,'/edgeleft ',edgeleft: pwid:pdec,' cm def'); writeln(a,'/edgeright ',edgeright:pwid:pdec,' cm def'); writeln(a,'/edgelow ',edgelow: pwid:pdec,' cm def'); writeln(a,'/edgehigh ',edgehigh: pwid:pdec,' cm def'); writeln(a); (* move image and scale it: *) writeln(a,'/deltaXcm ',deltaXcm:10:5,' cm def'); writeln(a,'/deltaYcm ',deltaYcm:10:5,' cm def'); writeln(a,'/scaleimage ',scaleimage:10:5,' def'); writeln(a,'/colorlistcontrol (',colorlistcontrol,') def'); writeln(a); writeln(a,'% based on typefaces program from page 40 of the Blue book'); writeln(a); writeln(a,'% variables'); writeln(a,'/defcharacterratio ',defcharacterratio:pwid:pdec,' def'); writeln(a,'/fontsize ',fontsize:1,' def'); writeln(a,'/lineseparation fontsize def'); writeln(a,'/thefont /Courier-Bold def'); writeln(a); writeln(a,'% set the font'); (* original code: writeln(a,'thefont findfont fontsize scalefont setfont'); writeln(a); *) (* 2005 Jan 26: f function for fonts *) writeln(a,'/f {findfont fontsize scalefont setfont} def'); writeln(a,'thefont f'); writeln(a); writeln(a,'/dosymbol {% dosymbol [symbol] - make a symbol'); writeln(a,'% see page 272 in the Red book'); writeln(a,'/thissymbol exch def'); writeln(a,'% switch to the Symbol font'); writeln(a,'/Symbol f'); writeln(a,'thissymbol show'); writeln(a,'% switch back to the standard font'); writeln(a,'thefont f'); writeln(a,'} def'); writeln(a,'/n {'); writeln(a,'/currenty currenty lineseparation sub def'); writeln(a,'0 currenty moveto} def'); writeln(a,'/s {show} def'); writeln(a,'/sn {s n} def'); writeln(a); writeln(a,'colorlistcontrol (R) ne'); (* default is portrait mode *) writeln(a,'{ % normal page display: portrait mode'); writeln(a,' /topofpage ',topofpage:pwid:pdec,' cm def'); writeln(a,' /startpage{'); {zboundingbox} (* the factor of a single fontsize is empirical ... *) writeln(a,' deltaXcm fontsize add deltaYcm translate'); writeln(a,' scaleimage dup scale'); writeln(a,' 0 topofpage moveto'); (* get current x and y, throw away the x: *) writeln(a,' /currenty currentpoint exch pop def'); writeln(a,' } def'); writeln(a,'}'); (* --------------------------- *) writeln(a,'{ % page rotation to landscape mode'); writeln(a,' /topofpage ',0.0:pwid:pdec,' cm def'); writeln(a,' /startpage{'); {zboundingbox} (* the factor of 1.5 is empirical ... *) writeln(a,' deltaXcm fontsize 1.5 mul add'); writeln(a,' deltaYcm fontsize defcharacterratio 2 mul mul add'); writeln(a,' translate'); writeln(a,' +90 rotate'); writeln(a,' scaleimage dup scale'); writeln(a,' 0 topofpage moveto'); (* get current x and y, throw away the x: *) writeln(a,' /currenty currentpoint exch pop def'); writeln(a,' } def'); writeln(a,'}'); writeln(a,'ifelse'); writeln(a); (* set up the color statements *) reset(colors); if not eof(colors) then while not eof(colors) do begin if colors^ <> '*' then begin (* skip comment lines *) (* implement the backslash protection scheme: *) if colors^ = '\' then get(colors); readln(colors,symbol,red,green,blue); write(a,'/'); protectpostscript(a,symbol); write(a,symbol,'{'); if (red = 1.0) or (red = 0.0) then write(a,round(red):1) else write(a,red:pwid:pdecolor); write(a,' '); if (green = 1.0) or (green = 0.0) then write(a,round(green):1) else write(a,green:pwid:pdecolor); write(a,' '); if (blue = 1.0) or (blue = 0.0) then write(a,round(blue):1) else write(a,blue:pwid:pdecolor); writeln(a,' setrgbcolor (',symbol,') s} def'); end else readln(colors); end else begin writeln(a,'/a {0 1 0 setrgbcolor (a) s} def'); writeln(a,'/c {0 0.9372 1 setrgbcolor (c) s} def'); writeln(a,'/g {1 0.7 0 setrgbcolor (g) s} def'); writeln(a,'/t {1 0 0 setrgbcolor (t) s} def'); writeln(a); end; writeln(a,'/b {0 0 0 setrgbcolor} def'); (* set black *) writeln(a,'/e {( ) s} def'); (* make empty space *) end; (* end module alist.startpostscript *) procedure readcolumnname(var f: text); (* read the columnname from file f *) var done: boolean; (* done reading f? *) begin reset(f); readvalues := false; columnlength := 0; if not eof(f) then begin get(f); (* skip the "*" *) if not eoln(f) then begin get(f); (* skip the " " *) if not eoln(f) then begin while not eoln(f) do begin columnlength := succ(columnlength); read(f,columnname[columnlength]); readvalues := true; end; readln(f) end end end; (* Skip through header information. If we hit end of file, then there is no data and readvalues should be false. *) done := false; if readvalues then begin while not done do begin if eof(f) then begin readvalues := false; done := true end else begin if f^ = '*' then readln(f) else done := true end end; end; end; procedure writecolumnname(var f: text); (* write the columnname to file f *) var i: integer; (* index to the column name *) begin for i := 1 to columnlength do write(f,columnname[i]); end; procedure getcolumnvalue(var f: text; column: integer; var value: real); (* get the column value from file f *) var c: integer; (* index to the columns *) gotit: boolean; (* whether we got the value *) begin gotit := false; while (not eof(f)) and (not gotit) do begin if f^='*' then readln(f) else begin for c := 1 to column-1 do skipcolumn(f); if not eof(f) then begin readln(f,value); gotit := true end; end; end; if not gotit then begin writeln(output, 'getcolumnvalue: could not locate the column ', column:1,' value'); writeln(output,'in the avalues file at sequence number ',number:1); if eof(f) then writeln(output,'end of file avalues was found'); halt end; end; procedure showalignment; (* show the numbers of all the bases relative to aligned base *) var lines, blanks, index: integer; begin figureblanks(blanks); numberbar(list, blanks, fromdo, todo, lines); (* now show a bar of dots to make it easier to read *) for index:=1 to blanks do write(list, ' '); for index:=fromdo to todo do write(list, '.'); if readvalues then begin write(list,' '); writecolumnname(list); end; writeln(list); linenumber:=linenumber+lines+1; end; procedure cshowalignment; (* show the numbers of all the bases relative to aligned base in color *) var lines, blanks, index: integer; begin figureblanks(blanks); (* writeln(output,'positionwidth=',positionwidth:1); writeln(output,'namewidth=',namewidth:1); writeln(output,'numberwidth=',numberwidth:1); writeln(output,'blanks=',blanks:1); *) pnumberbar(clist, blanks, fromdo, todo, lines); (* now show a bar of dots to make it easier to read *) write(clist,'('); for index:=1 to blanks do write(clist, ' '); for index:=fromdo to todo do write(clist, '.'); if readvalues then begin write(clist,' '); writecolumnname(clist); end; write(clist,') sn'); if cpagenumber > 1 then removeit(clist) else writeln(clist); clinenumber:=clinenumber+lines+1 end; procedure showpage(var a: text); (* show the page *) begin writeln(a,'b'); write(a,'showpage'); removeit(a) end; (* begin module checknumber *) function checknumber(var afile: text): boolean; (* check that there is a number next in the file. If not, return false. This is useful for protection when reading a parameter file. *) var ok: boolean; (* result of this check *) procedure conclude; begin writeln(output,'Including this character, the rest of the data line is:'); copyaline(afile,output); ok := false; end; begin ok := true; (* be optimistic *) if eof(afile) then begin ok := false; write (output,'A number was expected on a data line, but'); writeln(output,' the end of the file was found instead.'); end else begin skipblanks(afile); if eoln(afile) then begin write (output,'A number was expected on a data line, but'); writeln(output,' the end of the line was found instead.'); conclude; end; if not (afile^ in ['0','1','2','3','4','5','6','7','8','9','.','-','+']) then begin write (output,'A number was expected on a data line, but'); writeln(output,' the character "',afile^,'" was found instead.'); conclude; end; end; checknumber := ok end; (* end module checknumber version = 5.27; (@ of prgmod.p 2005 Aug 06 *) (* begin module copyfile *) procedure copyfile(var fin, fout: text); (* copy the rest of file fin to fout *) begin while not eof(fin) do copyaline(fin, fout); end; (* end module copyfile version = 5.27; (@ of prgmod.p 2005 Aug 06 *) (* begin module almostcopyfile *) procedure almostcopyfile(var fin, fout: text); (* copy file fin to fout EXCEPT the last line, which for an old alist file was: alistp: parameters for alist 5.85 and higher This is detected by an 'a' being in the first line. Crude but effective ... *) begin while not eof(fin) do begin if fin^ <> 'a' then copyaline(fin, fout) else readln(fin); end; end; (* end module almostcopyfile *) (* begin module alist.upgradeto596 *) procedure upgradeto596; (* upgrade the alistp file to version 5.96. This allows me to do multiple upgrade routines. *) var internal: text; (* a place to hold the old alistp *) begin parameterversion := 5.96; writeln(output, 'upgrading to version ',parameterversion:4:2,' ...'); reset(alistp); (* there was no version parameter to skip before this point *) rewrite(internal); almostcopyfile(alistp, internal); rewrite(alistp); writeln(alistp,parameterversion:4:2,' version of', ' alistp that this parameter file is designed for.'); reset(internal); copyfile(internal, alistp); (* add the new material at the end: *) writeln(alistp, 'n 0 0 0 0 edgecontrol (p=page),', ' edgeleft, edgeright, edgelow, edgehigh in cm'); reset(alistp); (* ready to start reading again *) end; (* end module alist.upgradeto596 *) (* begin module alist.upgradeto598 *) procedure upgradeto598; (* upgrade the alistp file to version 5.98: add fontsize and the deltaXcm, deltaYcm, and scaleimage parameters *) var internal: text; (* a place to hold the old alistp *) begin parameterversion := 5.98; writeln(output, 'upgrading to version ',parameterversion:4:2,' ...'); (* copy alist to internal *) reset(alistp); readln(alistp); (* skip old parameter version line *) rewrite(internal); copyfile(alistp, internal); (* copy internal to alist *) reset(internal); rewrite(alistp); writeln(alistp,parameterversion:4:2,' version of', ' alistp that this parameter file is designed for.'); copyfile(internal, alistp); (* add the new material at the end: *) writeln(alistp, defcolorlistcontrol:1, ' ',deffontsize:1, ' mapcontrol:', ' C=do map, R= rotate, char height (72 points/inch)'); writeln(alistp, defdeltaXcm:3:1, ' ', defdeltaYcm:4:1, ' ', defscaleimage:3:1, ' amount to move image in x and y (cm) and scale factor'); reset(alistp); (* ready to start reading again *) end; (* end module alist.upgradeto598 *) (* begin module alist.upgradeto620 *) procedure upgradeto620; (* upgrade the alistp file to version 6.20: add fontsize and the deltaXcm, deltaYcm, and scaleimage parameters *) var internal: text; (* a place to hold the old alistp *) begin parameterversion := 6.20; writeln(output, 'upgrading to version ',parameterversion:4:2,' ...'); (* copy alist to internal *) reset(alistp); readln(alistp); (* skip old parameter version line *) rewrite(internal); copyfile(alistp, internal); (* copy internal to alist *) reset(internal); rewrite(alistp); writeln(alistp,parameterversion:4:2,' version of', ' alistp that this parameter file is designed for.'); copyfile(internal, alistp); (* add the new material at the end: *) writeln(alistp, 'h headercontrol: h(eader);', ' 0: no header, no numbar; else numbar'); reset(alistp); (* ready to start reading again *) end; (* end module alist.upgradeto620 *) (* begin module alist.upgradeparameters *) procedure upgradeparameters(var alistp: text); (* make sure that the parameters are the latest spiffy version *) begin readln(alistp, parameterversion); if parameterversion < updateversion then begin writeln(output, 'You have an old parameter file, version ', parameterversion:4:2,'!'); if parameterversion < 5.96 then upgradeto596; reset(alistp); readln(alistp, parameterversion); if parameterversion < 5.98 then upgradeto598; reset(alistp); readln(alistp, parameterversion); if parameterversion < 6.18 then upgradeto620; reset(alistp); readln(alistp, parameterversion); if parameterversion < updateversion then begin writeln(output, 'Sorry! I am unable to fully upgrade', ' your parameter file'); writeln(output, 'from version ', parameterversion:4:2, ' to version ', updateversion:4:2,'!'); writeln(output, 'Start from a fresh copy or edit this one.'); halt; end else writeln(output, '... upgrade successful!'); writeln(output, 'See this page for the new documentation:'); writeln(output, 'http://www.lecb.ncifcrf.gov/~toms/delila/alist.html'); end; end; (* end module alist.upgradeparameters *) (* begin module alist.readparameters *) procedure readparameters; (* read the parameters *) var checkout: boolean; (* if true, all variable values are ok *) procedure cn; (* short version of call to check number *) begin checkout := checknumber(alistp); if not checkout then halt; (* avoid snowballing *) end; begin (* readparameters *) (* predefine all the parameters so the parameter file can have some missing - this probably should be removed ... *) fromdo := fromparam; todo := toparam; userrange := false; displaylevel := ' '; usefullname := ' '; paging := ' '; alignmenttype := 'i'; column := 6; columnwid := 6; columndec := 2; edgecontrol := 'p'; fontsize := deffontsize; deltaXcm := defdeltaXcm; deltaYcm := defdeltaYcm; scaleimage := defscaleimage; colorlistcontrol := ' '; mapcontrol := false; headercontrol := 'h'; (* read parameters *) reset(alistp); if not eof(alistp) then begin upgradeparameters(alistp); readln(alistp, fromdo, todo); if fromdo > todo then begin writeln(output,'from position (',fromdo:1, ') must be less than or equal to to position (', todo:1,')'); halt end; userrange := true; if not eof(alistp) then readln(alistp,displaylevel,usefullname); if not eof(alistp) then readln(alistp,paging); if not eof(alistp) then begin readln(alistp,alignmenttype); if not (alignmenttype in ['f','i','b']) then begin writeln(output,'alignment type must be f, b, or i'); halt end; end; if eof(alistp) then begin writeln(output,'you are missing parameter', ' columntoread etc of alistp!'); halt end; cn; readln(alistp,columntoread,columnwid,columndec); if eof(alistp) then begin writeln(output,'you are missing parameter', ' edgecontrol etc of alistp!'); halt end; read(alistp, edgecontrol); if (edgecontrol <> 'p') then begin read(alistp, edgeleft, edgeright, edgelow, edgehigh) end; readln(alistp); if eof(alistp) then begin writeln(output,'you are missing parameter', ' fontsize etc of alistp!'); halt end; read(alistp,colorlistcontrol); if colorlistcontrol in ['C','R'] then begin mapcontrol := true; cn; readln(alistp, fontsize); end else begin readln(alistp); mapcontrol := false; end; cn; read(alistp,deltaXcm); cn; read(alistp,deltaYcm); cn; readln(alistp,scaleimage); readln(alistp, headercontrol); end; end; (* end module alist.readparameters *) (******************************************************************************) (******************************************************************************) (******************************************************************************) begin writeln(output,'alist ',version:4:2); readparameters; (* conversion factor from cm to points *) cmfactor := 72 / 2.54 ; (* (72 points / inch) / (2.54 cm per inch) *) rewrite(list); rewrite(clist); linenumber := 0; if headercontrol = 'h' then begin writeln(list,'alist ',version:4:2,', aligned listing of book:'); linenumber := linenumber + 1; splitbooktitle(book, list); linenumber := linenumber + 2; (* the split makes two lines! *) end; (* this test must be done before the call to startpostscript! *) clinenumber := 0; if (headercontrol = 'h') or (headercontrol <> '0') then headerclinenumber := headerclines else headerclinenumber := 0; pagenumber:=1; cpagenumber:=1; (* get the column name *) readcolumnname(avalues); (* start reading the inst file *) reset(inst); if eof(inst) then if alignmenttype = 'i' then begin writeln(output,'forcing alignment to be on book', ' because there are no instructions'); alignmenttype := 'b' end; (* start reading the book file *) new(apiece); brinit(book, theline); if displaylevel = 'p' then maxname(book, theline, 'p', namewidth, list, linenumber, org, orgchange, orgopen, chr, chrchange, chropen, pie, piechange, pieopen) else maxname(namebook, theline, 'g', namewidth, list, linenumber, org, orgchange, orgopen, chr, chrchange, chropen, pie, piechange, pieopen); reset(namebook); orgchange := false; chrchange := false; piechange := false; orgopen := false; chropen := false; pieopen := false; maxnamelist(namelist,namelistwidth); reset(namelist); maxfullnamewidth(book,theline,fullnamewidth); brinit(book,theline); getpositions(inst, book, positionwidth, numberwidth, sequences, alignmenttype); writeln(output,sequences:1,' sequences in the book'); maxminalignment(inst,book,theline, fromparam,toparam,alignmenttype); writeln(output, 'available range: ',fromparam:1, ' ',toparam:1); programname.letters[1] := 'a'; programname.letters[2] := 'l'; programname.letters[3] := 'i'; programname.letters[4] := 's'; programname.letters[5] := 't'; programname.length := 5; startpostscript(clist,colors,programname, deltaXcm, deltaYcm, scaleimage, defaultllx, defaultlly, defaulturx, defaultury, fromdo, todo, sequences, cmfactor, headerclinenumber); writeln(clist,'startpage'); if headercontrol = 'h' then begin write(clist,'(alist ',version:4:2,', aligned listing of book: ) sn'); noheader(clist); clinenumber := clinenumber + 1; (* copy the book title to the clist on two lines: *) write(clist, '('); copytocomma(book, clist); copytocomma(book, clist); write(clist, ') sn'); noheader(clist); clinenumber := clinenumber + 1; write(clist, '('); write(clist, ' '); (* nifty extra space at start aligns things *) copynoreturn(book, clist); write(clist, ') sn'); noheader(clist); clinenumber := clinenumber + 1; noheader(clist); write(output,'alignment by '); write(list,'The alignment is by '); case alignmenttype of 'f': begin writeln(output,'first base'); writeln(list,'first base'); end; 'i': begin writeln(output,'delila instructions'); writeln(list,'delila instructions'); end; 'b': begin writeln(output,'book coordinates'); writeln(list,'book coordinates'); end; end; linenumber := linenumber + 2; { (* It isn't clear to me at the moment what the actual range of the book is in the other cases, so it is best not to report the wrong thing! *) if alignmenttype = 'i' then begin 1997 April 23 - I think it's ok now. } writeln(list, 'The book is from: ', fromparam:1, ' to ', toparam:1); linenumber := linenumber + 1; write(clist, '(The book is from: ', fromparam:1, ' to ', toparam:1,') sn'); noheader(clist); clinenumber := clinenumber + 1; { end; } writeln(list, 'This alignment is from: ', fromdo:1, ' to ', todo:1); writeln(list); linenumber := linenumber + 2; write(clist, '(This alignment is from: ', fromdo:1, ' to ', todo:1,') sn'); noheader(clist); clinenumber := clinenumber + 1; (* check that the number of header lines actually written matches the constants at the top of the program. *) { headerlinenumber := linenumber; if headerlinenumber <> headerlines then begin writeln(output,'program list header problem'); writeln(output,' actual headerlinenumber = ',headerlinenumber:1); writeln(output,' const headerlines = ',headerlines:1); halt; end; headerclinenumber := clinenumber; if headerclinenumber <> headerclines then begin writeln(output,'program clist header problem'); writeln(output,' actual headerclinenumber = ',headerclinenumber:1); writeln(output,' const headerclines = ',headerclines:1); halt; end; 2001 Mar 26: If one turns off piece names this changes - I'm not sure why I put this check in, but it seems unreasonable. Probably some other program depends on the header lines matching? } end; { else headerclinenumber := headerclines; else headerclinenumber := clinenumber; writeln(output,'>>>> clinenumber = ',clinenumber:1); writeln(output,' actual headerclinenumber = ',headerclinenumber:1); writeln(output,' const headerclines = ',headerclines:1); } if (headercontrol = 'h') or (headercontrol <> '0') then begin showalignment; cshowalignment; end; while not eof(book) do begin case alignmenttype of 'i': align(inst,book,theline,apiece,length,alignedbase); 'b','f': begin getpiece(book,theline,apiece); (* read in the piece *) length := piecelength(apiece); end; end; if not eof(book) then begin case alignmenttype of 'f': alignedbase := 1; (* force alignment on first base *) 'i': ; (* use the alignedbase from the book *) 'b': alignedbase := pietoint(0, apiece); (* use the internal book *) end; writeln(clist, 'b'); if usefullname = 'l' then begin write(clist,'('); with apiece^.key.hea.fulnam^ do begin for index := 1 to length do begin write( list,letters[index]); write(clist,letters[index]); end; (* note the extra blank for padding *) for index := length+1 to fullnamewidth+1 do begin write(clist,' '); write( list,' '); end; end; writeln(clist,') show'); end; if (displaylevel = 'p') or (displaylevel = 'c') then begin { writeln(output,'displaylevel is p'); writeln(output,'namewidth = ',namewidth:1); for index := 1 to namewidth do write(output,apiece^.key.hea.keynam.letters[index]); writeln(output,'done'); } if (displaylevel = 'p') then for index := 1 to namewidth do write(list,apiece^.key.hea.keynam.letters[index]); write(list,' ',inttopie(alignedbase,apiece):positionwidth); write(clist,'('); if (displaylevel = 'p') then for index := 1 to namewidth do write(clist,apiece^.key.hea.keynam.letters[index]); write(clist,' ',inttopie(alignedbase,apiece):positionwidth); write(clist,') s '); end else if not emptyfile(namebook) then printname(namebook, theline, nametype, namewidth, list, clist, org, orgchange, orgopen, chr, chrchange, chropen, pie, piechange, pieopen, linenumber, clinenumber); if not emptyfile(namelist) then begin write(list,' '); (* extra blank in front of name *) write(clist,'( '); (* extra blank in front of name *) index := 0; while not eoln(namelist) do begin index := index + 1; read(namelist,cnamelist); write(list,cnamelist); write(clist,cnamelist) end; for indexfill := 1 to namelistwidth - index - 1 do begin write( list,' '); write(clist,' '); end; writeln(clist,') show'); readln(namelist); end; if (displaylevel = 'p') or (displaylevel = 'c') then begin (* give the orientation *) if apiece^.key.piedir = minus then thedirection := '-' else thedirection := '+'; write(list,' ',thedirection); writeln(clist, '( ',thedirection,') s'); end; if numbered then write(list, ' ', number:numberwidth, ' ') else write(list, ' ' ); if numbered then writeln(clist, '( ', number:numberwidth, ' ) s') else writeln(clist, '(',' ':numberwidth,') s'); column := 0; for index := fromdo to todo do begin if withinalignment(index, alignedbase, length) then begin b := basetochar(getbase(index+alignedbase, apiece)); write(list,b); write(clist,' ',b); end else begin write(list, ' '); write(clist, ' e'); end; column := column + 2; (* note: the number in the next line must be divisible by 2 or the lines will never be broken *) if (column mod 76) = 0 then begin writeln(clist); column := 0 end; end; (* give the avalue column *) if readvalues then begin getcolumnvalue(avalues, columntoread, columnvalue); write(list,' ',columnvalue:columnwid:columndec); write(clist,' ( ',columnvalue:columnwid:columndec,') b s'); end; writeln(list); writeln(clist,' n'); linenumber:=succ(linenumber); clinenumber:=succ(clinenumber); if paging <> 'n' then begin if linenumber > cpagelength then begin (* modified 2002 apr 19 *) page(list); pagenumber:=succ(pagenumber); writeln(list, 'page ', pagenumber:1); linenumber:=2; showalignment end; (* paging is done to the clist at all times! 2001 Nov 5 - well poo on that!! *) (* 2007 Nov 29 change from > to >= *) if clinenumber >= cpagelength then begin cpagenumber:=succ(cpagenumber); (* just at the end of a page make sure that the printer is reset to black printing by the 'b' function *) showpage(clist); write(clist,'startpage'); removeit(clist); write(clist, '(page ', cpagenumber:1,') sn'); removeit(clist); clinenumber:=2; clinenumber:=1; (* 2007 Nov 29 *) cshowalignment end; end; clearpiece(apiece); end end; if clinenumber > 2 then showpage(clist); removeit(clist); (* create end of EPS file *) writeln(clist,'%%Trailer'); 1: end. (* alist *)