* 1999/05/23 21:41:28, 1999/03/17 23:16:57, library to test delila organism - book produced by delila 2.19 * E.xamples * example long name (organism) * bases chromosome * E.xamples * example long name (chromosome) * 1.00 * 14543.00 piece * LINEAR * a small linear DNA sequence note * #1 * same as the start of AF010238 note * 1.00 * linear * + * 1 * 180 * linear * + * 1 * 180 dna * gaattcagttagttgactttttgtactttataagcgtgatgattgggtgttcccgtgtga * gaattcagttagttgactttttgtactttataagcgtgatgattgggtgttcccgtgtga * gaattcagttagttgactttttgtactttataagcgtgatgattgggtgttcccgtgtga dna piece piece * CIRCULAR * a small circular DNA sequence note * #1 * small circle, 20 bases of LINEAR note * 1.00 * circular * + * 1 * 20 * circular * + * 1 * 20 dna * gaattcagttagttgacttt dna piece chromosome organism