program malign(inst, book, malignp, uncert, newalign, optalign, optinst, malignxyin, output); (* optimal alignment of sequences in a book, to minimize uncertainty by David Mastronarde and Dr. Thomas D. Schneider National Institutes of Health National Cancer Institute Center for Cancer Research Nanobiology Program Molecular Information Theory Group Frederick, Maryland 21702-1201 toms@ncifcrf.gov permanent email: toms@alum.mit.edu (use only if first address fails) http://www.ccrnp.ncifcrf.gov/~toms/ module libraries: delman, delmod *) label 1; (* end of program *) const (* begin module version *) version = 2.56; (* of malign.p 2005 Sep 28 2005 Sep 28: 2.56: insert malign.xyplop 2005 Feb 7: 2.55: cleanup 2005 Feb 7: 2.54: crash: "second operand of `mod' is <= 0" 2005 Jan 27: 2.53: increase maxnseq from 5000 to 10000 2001 Jul 10: 2.52: upgrade documentation 2001 Apr 18: 2.51: document file output 2000 Dec 13: 2.47: upgrade alignment for comments 2000 Jun 29: 2.47: upgrade documentation 2000 Feb 23: 2.44: add alignmenttype; upgrade delmod modules 1999 August 26: 2.44: add spaces to optinst so big numbers don't get fused together. STUPID. 1999 July 22: 2.43: change xyin to malignxyin to avoid conflicts 1999 June 17: 2.42: optinst has Delila 'same' instruction. 1998 Oct 19: range set to 1000 origin 1986 apr 22 *) (* end module version *) (* begin module describe.malign *) (* name malign: optimal alignment of a book, based on minimum uncertainty synopsis malign(inst: in, book: in, malignp: in, uncert: out, newalign: out, optalign: out, optinst: out, malignxyin: out, output: out) files inst: delila instructions of the form 'get from 56 -5 to 56 +10;' book: the book generated by delila using inst malignp: parameter file with the following parameters: winleft, winright: left and right ends of window for calculating uncertainty, relative to aligned base shiftmin, shiftmax: minimum and maximum shift of aligned base iseed: integer random seed nranseq: number of random sequences, or 0 to use sequences in book nshuffle: number of times to redo alignment after random shuffle ifpaired: 1 to treat each pair of sequences as complementary strands, 0 not to standout: output run #, pass # and H to standard output every pass if 1, every run if 0, or not at all if -1 npassout: output H and alignment every npassout passes to file newalign, or only at end of runs if zero, or not at all if -1 nshiftout: output L and H(L) every nshiftout sequence shifts (to file uncert), or only at end of passes if zero, or not at all if -1 tolerance: tolerance in change of H ntolpass: maximum number of passes with change below tolerance new parameter allowed but not required (default is i): alignmenttype: char; 'f' means alignment by First internal coordinate base, 'b' means alignment by Book, 'i' means alignment by Instructions. See the alist program for more information. Normally one will align by delila instructions. If this parameter is 'f', then the first base of the book is considered the zero base and if it is 'b' then the zero base is given by the coordinates of each piece in the book. uncert: uncertainty as function of position, for the last run, at the end of each pass or after selected number of sequence shifts Controlled by variable nshiftout. newalign: values of H and the relative alignments; starting, final, and intermediate if selected. Controlled by variable npassout. optalign: user-readable listing of unique optimal relative alignments and number of times each was achieved optinst: list of unique optimal alignments in absolute coordinates, to be used to make inst file for selected alignment This file is like optalign, but the coordinates are for the original sequence. malignxyin: a list of the number of occurrences of alignments and their H values in bits. This may be plotted with xyplo, as described in the paper. Each line contains these numbers: rank: from 1 to the number of alignment classes occurrences: how many times the class was found H: the uncertainty of the alignment, in bits R: the information content of the alignment, in bits with small sample correction. description Given a book of aligned sequences, this program searches for the alignment of the sequences that has the lowest uncertainty, i.e. the highest value of Rsequence. The user specifies the "window" of bases within which uncertainty is calculated, and the maximum number of bases that each sequence is allowed to shift from the original alignment. The program considers each sequence in turn, shifting it to an alignment with minimum uncertainty while holding the other sequences fixed. A "pass" is complete when all sequences have been considered. A "run" is complete when no alignments have changed in the preceding pass, and the alignment is then considered "optimal". The first run starts with the original alignment; every run after that starts with a "shuffled" alignment obtained by shifting each sequence independently by a random amount between the allowed limits. The program maintains a list of all of the unique optimal alignments achieved from these starting alignments, and it outputs them in order of increasing uncertainty. In version 2.33 and earlier, the program did not keep track of the organism and chromosome names in bestinst. This file is now superceeded by the malin program which copies the inst file to cinst and modifies it according to one of the alignments in optinst. ******************************************************************************** Summary of file output: Malign produces: uncert, newalign, optalign, optinst, malignxyin, output -- output -- Line 7 of "malignp" controls output Parameter: 1 - every run, pass, and uncertainty will be outputed to the screen 0 - only the lowest uncertainty run will be outputed -1 - nothing will be outputed *NOTE* no file will be produced regardless of the parameter -- newalign -- Line 8 of "malignp" controls newalign Parameter: 1 - produces a full newalign file 0 - produces a smaller newalign file (about half the size) -1 - produces no newalign file *NOTE* this is the largest file produced and is unnecessary -- uncert -- Line 9 of "malignp" controls uncert Parameter: 1 - produces a full uncert file 0 - produces a smaller uncert file (about half the size) -1 - produces an empty uncert file *NOTE* file will be produced regardless of the parameter, however this file is large and unnecessary -- optalign -- *NOTE* this file will always be produced and is needed to run malin -- optinst -- *NOTE* this file will always be produced and is needed to run malin -- malignxyin -- *NOTE* this file will always be produced and can be used to plot data using xyplo If you set our parameters so newalign and uncert are not created, this can save some space. (Thanks to Brent M. Jewett for compiling this information on 2001 Feb 7.) ******************************************************************************** documentation A paper describing the algorithm in detail is available from ftp://ftp.ncifcrf.gov/pub/delila/malign.ps @article{Schneider.Mastronarde.malign, author = "T. D. Schneider and D. Mastronarde", title = "{Fast} multiple alignment of ungapped {DNA} sequences using information theory and a relaxation method", journal = "Discrete Applied Mathematics", note = "ftp://ftp.ncifcrf.gov/pub/delila/malign.ps", volume = "71", pages = "259-268", year = "1996"} The use of malign to align sequences with a subtle pattern is described in: @article{Toledano1994, author = "M. B. Toledano and I. Kullik and F. Trinh and P. T. Baird and T. D. Schneider and G. Storz", title = "Redox-Dependent Shift of {OxyR-DNA} Contacts Along An Extended {DNA} Binding Site: A Mechanism for Differential Promoter Selection", journal = "Cell", volume = "78", pages = "897-909", year = "1994"} For how the information content and small sample correction are computed: @article{Schneider1986, author = "T. D. Schneider and G. D. Stormo and L. Gold and A. Ehrenfeucht", title = "Information content of binding sites on nucleotide sequences", journal = "J. Mol. Biol.", volume = "188", pages = "415-431", year = "1986"} see also {Paper Schneider.Mastronarde.malign:} http://www.lecb.ncifcrf.gov/~toms/paper/malign/ {Program to graph the malignxyin file:} xyplo.p {You can use the} malign.xyplop { file for the xyplop and the malignxyin for the xyin. Set the xyplom to be empty. I ALWAYS make this graph to see what is going on.} {Program to make delila instructions from nth alignment of malign:} malin.p {Example parameter file, malignp:} malignp {A COMPLETE SET FOR DEMONSTRATING THE PROGRAM} malign.inst {instructions for grabbing the first 6 EcoRI sites on the E. coli genome, but messed up by setting the last digit to zero} malign.book {The Delila book corresponding to malign.inst} malign.malignp {Parameter file for malign to realign the inst and book.} {If one uses malin to pick the first alignment, one finds that they are correctly realigned: - + 1--------- +++++++++1 098765432101234567890 ..................... EcoRI U00096 3842 + 1 cgacctgccggaattcagcct U00096 12889 + 2 tctggttgaagaattcaagaa U00096 32545 + 3 tcagggtatcgaattcgacta U00096 50237 + 4 ggtattcagcgaattccacga U00096 56282 + 5 agaggtagcggaattcgttct U00096 96860 + 6 gctacgtcaggaattcctgct } {Program for listing aligned sequences, as above:} alist.p author David Mastronarde and Tom Schneider bugs The realignment algorithm, which shifts all sequences by the same amount to attempt to keep the window near its original position, is somewhat ad hoc in nature and the effects of different settings for it parameters have not been explored. If the window spans two real sites with competing alignments, many optimal but meaningless alignments with similar uncertainties may be obtained. The random sequences can't be examined. For the computation of Rsequence, composition is assumed to be equiprobable, there is no provision for reading in a cmp file yet. technical notes The malignxyin file Rsequence has the small sample correction. The choice between the estimate and the more exact computation is determined by constant "kickover". The constant maxlen is one longer than the longest sequence. The constant maxnseq is the maximum number of sequences. *) (* end module describe.malign *) maxlen=2002; (* 1 + maximum length of sequences *) maxnseq=10000; (* maximum number of sequences *) (* constants for the ad hoc realignment procedure; see "realign" *) maxchange=50; (* 2 times maximum change in alignments allowed during realignment *) minmaxforchange=3; (* minimum number of sequences that must have the same shift from their original alignments before all sequences will get realigned so as to restore that subset of sequences to original alignment *) realignlimit=10; (* maximum pass number on which to do realignment *) kickover = 50; (* e(hnb) for n values above this are estimated from ae(hnb) = hg - 3/(2 ln(2) n) while those below are calculated exactly *) (* begin module info.const *) infofield = 8; (* field size for bits *) infodecim = 5; (* decimal places for bits *) posfield = 4; (* field size for aligned sequence positions *) nfield = 4; (* size of field for printing n, the number of sites *) (* end module info.const *) (* begin module book.const *) (* constants needed for book manipulations *) dnamax = 1024; (* length of dna arrays *) namelength = 100; (* maximum key name length *) linelength = 80; (* maximum line readable in book *) (* end module book.const version = 7.56; {of delmod.p 2000 Nov 21} *) (* trigger definitions follow to make program compilable. The prgmod.p program has the triggers *) (* module filler.const *) fillermax = 50; (* the size of the filler array for a string *) (* module filler.const from prgmod.p 4.20 *) (* begin module interact.const *) (* begin module string.const *) maxstring = 150; (* the maximum string *) (* end module string.const version = 4.39; (@ of prgmod.p 1999 November 28 *) (* end module interact.const version = 7.56; {of delmod.p 2000 Nov 21} *) type (* begin module book.type *) (* types needed for book manipulations *) chset = set of 'a'..'z'; (* types defined in book definition *) alpha = packed array[1..namelength] of char; (* this is not alfa *) (* name is a left justified string with blanks following the characters *) name = record letters: alpha; length: 0..namelength (* zero means an unspecified structure *) end; lineptr = ^line; line = record (* a line of characters *) letters: packed array [1..linelength] of char; length: 0..linelength; next: lineptr end; direction = (plus, minus, dircomplement, dirhomologous); configuration = (linear, circular); state = (on, off); header = record (* header of key *) keynam: name; (* key name of structure *) fulnam: lineptr; (* full name of structure *) note: lineptr (* note key *) end; (* begin module base.type *) (* define the four nucleotide bases *) base = (a,c,g,t); (* end module base.type version = 7.56; {of delmod.p 2000 Nov 21} *) (* sequence types *) dnaptr = ^dnastring; dnarange = 0..dnamax; seq = packed array[1..dnamax] of base; dnastring = record part: seq; length: dnarange; next: dnaptr end; orgkey = record (* organism key *) hea: header; mapunit: lineptr (* genetic map units *) end; chrkey = record (* chromosome key *) hea: header; mapbeg: real; (* number of genetic map beginning *) mapend: real (* number of genetic map ending *) end; pieceptr = ^piece; piekey = record (* piece key *) hea: header; mapbeg: real; (* genetic map beginning *) coocon: configuration; (* configruation (circular/linear) *) coodir: direction; (* direction (+/-) relative to genetic map *) coobeg: integer; (* beginning nucleotide *) cooend: integer; (* ending nucleotide *) piecon: configuration; (* configruation (circular/linear) *) piedir: direction; (* direction (+/-) relative to coordinates *) piebeg: integer; (* beginning nucleotide *) pieend: integer; (* ending nucleotide *) end; piece = record key: piekey; dna: dnaptr end; reference = record pienam : name; (* name of piece referred to *) mapbeg : real; (* genetic map beginning *) refdir : direction; (* direction relative to coordinates *) refbeg : integer; (* beginning nucleotide *) refend : integer; (* ending nucleotide *) end; genkey = record (* gene key *) hea : header; ref : reference; end; trakey = record (* transcript key *) hea : header; ref : reference; end; markerptr = ^marker; markey = record (* marker key *) hea : header; ref : reference; sta : state; phenotype : lineptr; next : markerptr; end; marker = record key : markey; dna : dnaptr; end; (* end module book.type version = 7.56; {of delmod.p 2000 Nov 21} *) (* begin module interact.type *) (* begin module string.type *) stringptr = ^string; (* pointer to a string *) string = record (* a string of characters *) letters: array[1..maxstring] of char; (* the letters in the string *) length: integer; (* the number of characters in the string *) current: integer; (* the letter we are working on *) next: stringptr; (* the next string in a series *) end; (* end module string.type version = 4.39; (@ of prgmod.p 1999 November 28 *) (* end module interact.type version = 7.56; {of delmod.p 2000 Nov 21} *) (* module filler.type *) (* the following is an array used to fill a string. it is convenient to have it much shorter than the maxstring, so that it is easy to fill the string using procedure fillstring. the user must declare the value of constant fillermax. *) filler = packed array[1..fillermax] of char; (* module filler.type from prgmod.p 4.20 *) (* module trigger.type *) trigger = record (* an object to be searched for *) seek: string; (* the characters looked for *) state: integer; (* how close to triggering we are *) skip: boolean; (* trigger not found- skip the line *) found: boolean (* the trigger was found *) end; (* module trigger.type from prgmod.p 4.20 *) seqrecptr = ^seqrec; (* pointer to a seqrec record *) seqrec = record (* sequences and alignment info *) alseq: array[1..maxlen] of base; (* the sequence *) length: integer; (* number of bases *) piecename: name; (* name of the piece *) alignread: integer; (* alignment read in from file *) alignstart: integer; (* alignment at start of run *) aligncurrent: integer; (* current alignment *) alignmin: integer; (* minimum alignment *) alignmax: integer; (* maximum alignment *) next: seqrecptr (* pointer to next record *) end; matrix = array[base,1..maxlen] of integer; (* array for n(B,L) table *) poslist = array[1..maxlen] of real; (* array for H(L) values *) fltable = array[0..maxnseq] of real; (* array for f*log(f) and diffs *) optlistptr= ^optlist; (* pointer to optlist record *) optlist= record (* storage for unique optimal alignments *) albest: array[1..maxnseq] of integer; (* the alignments *) hbest: real; (* the h value *) num: integer; (* number of times achieved *) next: optlistptr (* pointer to next record *) end; var inst, (* the delila instructions required by the align procedures *) book, (* the book to be aligned *) malignp, (* parameter file *) uncert, (* uncertainty as function of position *) newalign, (* values of H and relative alignments *) optalign, (* set of unique optimum relative alignments *) optinst, (* set of unique optimum absolute alignments *) malignxyin: (* ranking, occurrences and H *) text; winleft, winright, (* left and right ends of window for calculating uncertainty, relative to aligned base *) shiftmin, shiftmax, (* minimum and maximum shift of aligned base *) iseed, (* integer random seed *) nranseq, (* number of random sequences, or 0 to use sequences in book *) nshuffle, (* number of times to redo alignment after random shuffle *) ifpaired, (* flag to treat pairs of sequences as complementary strand *) standout, (* standard output very pass, run, or not at all *) npassout, (* period at which to output H and alignment *) nshiftout, (* period at which to output L and H(L) *) ntolpass: integer; (* maximum number of passes below tolerance *) tolerance: real; (* tolerance in change of H *) nbl: matrix; (* the n(B,L) matrix *) hl: poslist; (* the H(L) array *) flogf, fldiff: fltable; (* tables of f*log(f) and differences of this *) fldoubl: fltable; (* table of flogf(i+2)-flogf(i) *) sepfirst, sep, seplast: seqrecptr; (* pointers to sequence records *) oapfirst, oap, oaplast: optlistptr; (* pointers to alignment records *) rand, (* random number returned by random *) horiginal, (* value of h at starting alignment *) hcurrent, hpass: real; (* values of H currently and at end of pass *) numseq, (* number of sequences *) window, (* length of window *) shuffle, (* index for shuffling loop *) numopt, (* number of optimal alignments on list *) globshift, (* global shift when realigning all sequences *) iseedparam, (* random seed as read in *) iseed2, (* secondary seed used to resolve ties in minimum H *) iseedsave, (* value of seed before shuffling for current run *) notchanged, (* number of sequences over which no change has been made *) intolerance: integer; (* number of passes where H changed < tolerance *) paired: boolean; (* boolean value for whether sequences paired *) alignmenttype: char; (* 'f' means alignment by First internal coordinate base, 'b' means alignment by Book, 'i' means alignment by Instructions *) theline: integer; (* current line in the book *) (* begin module book.var *) (* ************************************************************************ *) (* global variables needed for book manipulations *) (* free storage: *) freeline: lineptr; (* unused lines *) freedna: dnaptr; (* unused dnas *) readnumber: boolean; (* whether to read a number from the notes, or to read in the notes *) number: integer; (* the number of the item just read *) numbered: boolean; (* true when the item just read is numbered *) skipunnum: boolean; (* a control variable to allow skipping of un-numbered items in the book *) (* ************************************************************************ *) (* end module book.var version = 7.56; {of delmod.p 2000 Nov 21} *) (* begin module halt *) procedure halt; (* stop the program. the procedure performs a goto to the end of the program. you must have a label: label 1; declared, and also the end of the program must have this label: 1: end. examples are in the module libraries. this is the only goto in the delila system. *) begin writeln(output,' program halt.'); goto 1 end; (* end module halt version = 7.56; {of delmod.p 2000 Nov 21} *) (* begin module copyaline *) procedure copyaline(var fin, fout: text); (* copy a line from file fin to file fout *) begin (* copyaline *) while not eoln(fin) do begin fout^ := fin^; put(fout); get(fin) end; readln(fin); writeln(fout); end; (* copyaline *) (* end module copyaline version = 7.56; {of delmod.p 2000 Nov 21} *) (* begin module skipblanks *) procedure skipblanks(var thefile: text); (* skip over blanks until a non-blank, or end of line, is found *) begin while (thefile^ = ' ') and not eoln(thefile) do get(thefile); end; procedure skipnonblanks(var thefile: text); (* skip over nonblanks until a blank, or end of line, is found *) begin while (thefile^ <> ' ') and not eoln(thefile) do get(thefile); end; procedure skipcolumn(var thefile: text); (* skip over a data column *) begin skipblanks(thefile); skipnonblanks(thefile) end; (* end module skipblanks version = 7.56; {of delmod.p 2000 Nov 21} *) (* begin module interact.clearstring *) (* begin module clearstring *) procedure clearstring(var ribbon: string); (* empty the string *) var index: integer; (* to the ribbon *) begin (* clearstring *) with ribbon do begin for index := 1 to maxstring do letters[index] := ' '; length := 0; current := 0; end end; (* clearstring *) procedure initializestring(var ribbon: string); (* start the string with a nil pointer. This routine should be called before doing linked list work. This allows the standard string routines to clear the string without killing the pointer. *) begin (* initializestring *) clearstring(ribbon); ribbon.next := nil; end; (* initializestring *) (* end module clearstring version = 4.39; (@ of prgmod.p 1999 November 28 *) (* end module interact.clearstring version = 7.56; {of delmod.p 2000 Nov 21} *) (* begin module filler.fillstring *) procedure fillstring(var s: string; a: filler); (* this procedure makes it reasonably easy to fill the string s with characters. one calls the procedure as: *) (* 1 2 3 4 5 *) (* 12345678901234567890123456789012345678901234567890 *) (* fillstring(s, 'this-is-the-string '); the two comments make it easy to line the characters up. also, for this example, it was assumed that the length of filler as defined by the constant fillermax was 50. *) var length: integer; (* of the string without trailing blanks *) index: integer; (* of s *) begin (* fillstring *) clearstring(s); length := fillermax; while (length > 1) and (a[length] = ' ') do length := pred(length); if (length = 1) and (a[length] = ' ') then begin writeln(output, 'fillstring: the string is empty'); halt end; for index := 1 to length do s.letters[index] := a[index]; s.length := length; s.current := 1 end; (* fillstring *) (* end module filler.fillstring version = 7.56; {of delmod.p 2000 Nov 21} *) (* begin module filler.filltrigger *) procedure filltrigger(var t: trigger; a: filler); (* fill the trigger t *) begin (* filltrigger *) fillstring(t.seek,a) end; (* fillstring *) (* end module filler.filltrigger version = 7.56; {of delmod.p 2000 Nov 21} *) (* begin module trigger.proc *) (* this module allows one to scan a series of characters, as from an array or a file, and to "trigger" or detect a simple string in the series. the advantage of the trigger is that several triggers can "observe" a stream of characters at once, each looking for a different thing. some other modules required: interact.const, interact.type *) procedure resettrigger(var t: trigger); (* reset the trigger to ground state *) begin (* resettrigger *) with t do begin state := 0; skip := false; found := false end end; (* resettrigger *) procedure testfortrigger(ch: char; var t: trigger); (* look at the character ch. if it is part of the trigger (at the current trigger state), then the trigger state goes higher. if it is not part of the trigger then the trigger state is reset, skip is true and one should skip onward to find the trigger. if the trigger is found, found is true. 1996 Sep 12: Bug found! In the case of a trigger "ab", the program used to miss it for situations like "aab". This was because at the first a it would step up. Then it would see the second a and recognize that was not part of ab. It would fail to realize that it could be the start of a new one. The code now accounts for that possibility. *) begin (* testfortrigger *) with t do begin state := succ(state); { writestring(list,seek); writeln(list,'testfortrigger seek.letters[',state:1,']:', seek.letters[state],' ch:',ch); } if seek.letters[state] = ch then begin skip := false; if state = seek.length then found := true else found := false end else begin (* it failed. But wait! It could be the beginning of a NEW trigger string! *) if seek.letters[1] = ch then begin state := 1; skip := false; found := false end else begin (* reset trigger *) state := 0; skip := true; found := false end end end end; (* testfortrigger *) (* end module trigger.proc version = 7.56; {of delmod.p 2000 Nov 21} *) (* begin module package.align *) (* ************************************************************************ *) (* begin module package.getpiece *) (* ************************************************************************ *) (* begin module package.brpiece *) (* ************************************************************************ *) (* begin module book.basis *) (* procedures needed for book manipulations *) (* get procedures should be used for all linked lists of records *) procedure getline(var l: lineptr); (* obtain a line from the free line list or by making a new one *) begin if freeline<>nil then begin l:=freeline; freeline:=freeline^.next end else new(l); l^.length:=0; l^.next:=nil end; procedure getdna(var l: dnaptr); begin if freedna<>nil then begin l:=freedna; freedna:=freedna^.next end else new(l); l^.length:=0; l^.next:=nil end; (* clear procedures should be called each time the records are no longer needed failure to do this may result in a stack overflow. *) procedure clearline(var l: lineptr); (* return a line to the free line list *) var lptr: lineptr; begin if l<>nil then begin lptr:=l; l:=l^.next; lptr^.next:=freeline; freeline:=lptr end end; procedure writeline(var afile: text; l: lineptr; carriagereturn: boolean); (* write a line to a file, with carriage return if carriagereturn is true. *) var index: integer; (* index to characters in l *) begin with l^ do begin for index := 1 to length do write(afile, letters[index]); end; if carriagereturn then writeln(afile); end; procedure showfreedna; (* show the freedna list *) var counter: integer; (* count of freedna list *) l: dnaptr; (* pointer into freedna list *) begin l := freedna; counter := 0; while l <> nil do begin counter := succ(counter); write(output,counter:1); write(output, ', length = ',l^.length:1); { This is illegal according to gpc because one cannot write a pointer to a text file. It can be unearthed for debugging. write(output, ', pointer id: ',l:1); } writeln(output); l := l^.next end; end; procedure cleardna(var l: dnaptr); var lptr: dnaptr; begin if l<>nil then begin lptr:=l; l:=l^.next; lptr^.next:=freedna; freedna:=lptr end end; procedure clearheader(var h: header); (* clear the header h (remove lines to free storage) *) begin with h do begin clearline(fulnam); while note<>nil do clearline(note) end end; procedure clearpiece(var p: pieceptr); (* clear the dna of the piece *) begin while p^.dna<>nil do cleardna(p^.dna); clearheader(p^.key.hea) end; function chartobase(ch:char):base; (* convert a character into a base *) begin case ch of 'a': chartobase:=a; 'c': chartobase:=c; 'g': chartobase:=g; 't': chartobase:=t end end; function basetochar(ba:base):char; (* convert a base into a character *) begin case ba of a: basetochar:='a'; c: basetochar:='c'; g: basetochar:='g'; t: basetochar:='t'; end end; function complement(ba:base):base; (* take the complement of ba *) begin case ba of a: complement:=t; c: complement:=g; g: complement:=c; t: complement:=a; end end; function chomplement(b: char): char; (* create the character complement of base b. I must be getting hungry! *) begin chomplement := basetochar(complement(chartobase(b))); end; function pietoint(p: integer; pie: pieceptr): integer; (* p is a coordinate on the piece. we want to transform p into a number from 1 to n: an internal coordinate system for easy manipulation of piece coordinates *) var i: integer; (* an intermediate value *) begin with pie^.key do begin case piedir of plus: if p>=piebeg then i:=p-piebeg+1 else i:=(p-coobeg)+(cooend-piebeg)+2; minus: if p<=piebeg then i:=piebeg-p+1 else i:=(cooend-p)+(piebeg-coobeg)+2 end; pietoint:=i end end; function inttopie(i: integer; pie: pieceptr):integer; (* i is in the range 1 to some maximum. it is an internal coordinate system for the program. we want to do a coordinate transformation to obtain a value in the range of the piece called pie: i=1 corresponds to piebeg and i=its maximum corresponds to pieend *) var p: integer; (* an intermediate value *) begin with pie^.key do begin case piedir of plus: begin p:=piebeg+(i-1); if p>cooend then if coocon=circular then p:=p-(cooend-coobeg+1) end; minus: begin p:=piebeg-(i-1); if p '*' then begin writeln(output,' procedure skipstar: bad book'); writeln(output,' "*" expected as first character on the line, but "', thefile^,'" was found'); halt end; get(thefile); (* skip the star *) if thefile^ <> ' ' then begin writeln(output,' procedure skipstar: bad book'); writeln(output,' "* " expected on a line but "*', thefile^,'" was found'); halt end; get(thefile) (* skip the blank *) end end; (* skipstar *) (* end module book.skipstar version = 7.56; {of delmod.p 2000 Nov 21} *) (* begin module book.brreanum *) procedure brreanum(var thefile: text; var theline: integer; var reanum: real); (* read a real number from the file *) begin skipstar(thefile); readln(thefile,reanum); theline := succ(theline) end; (* end module book.brreanum version = 7.56; {of delmod.p 2000 Nov 21} *) (* begin module book.brnumber *) procedure brnumber(var thefile: text; var theline: integer; var num: integer); (* read a number from the file *) begin skipstar(thefile); readln(thefile,num); theline := succ(theline) end; (* end module book.brnumber version = 7.56; {of delmod.p 2000 Nov 21} *) (* begin module book.brname *) procedure brname(var thefile: text; var theline: integer; var nam: name); (* read a name from the file *) var i: integer; (* an index to the name *) c: char; (* a character read *) begin (* brname *) skipstar(thefile); with nam do begin length:=0; repeat length:=succ(length); read(thefile,c); letters[length] := c until (eoln(thefile)) or (length>=namelength) or (letters[length]=' '); if letters[length]=' ' then length:=length-1; if length 'n' then begin skipstar(thefile); if not eoln(thefile) then begin if thefile^ = '#' then begin numbered := true; get(thefile); (* move past the number symbol *) read(thefile,number); end end; repeat readln(thefile); theline := succ(theline) until thefile^ = 'n'; readln(thefile); theline := succ(theline) end else begin readln(thefile); theline := succ(theline) end end end; (* brnotenumber *) (* end module book.brnotenumber version = 7.56; {of delmod.p 2000 Nov 21} *) (* begin module book.brnote *) procedure brnote(var thefile: text; var theline: integer; var note: lineptr); (* read note key *) var newnote: lineptr; (* the new note *) previousnote: lineptr; (* the last line of the notes *) begin (* brnote *) note:=nil; if thefile^ = 'n' then begin (* enter note *) readln(thefile); theline := succ(theline); if thefile^ <> 'n' then begin (* abort null note (n/n) *) getline(note); newnote:=note; while thefile^ <> 'n' do begin (* wait until end of note *) brline(thefile,theline,newnote); previousnote:=newnote; (* get next note *) getline(newnote^.next); newnote:=newnote^.next; end; (* last note was not used, so: *) clearline(newnote); previousnote^.next:=nil; readln(thefile); theline := succ(theline); end else begin readln(thefile); theline := succ(theline); end; end end; (* brnote *) (* end module book.brnote version = 7.56; {of delmod.p 2000 Nov 21} *) (* begin module book.brheader *) procedure brheader(var thefile: text; var theline: integer; var hea: header); (* read the header of a key. *) begin with hea do begin readln(thefile); (* move past the object name - new definition 1999 Mar 13 *) theline := succ(theline); {bbb} (* read key name *) brname(thefile,theline,keynam); (* read full name *) getline(fulnam); brline(thefile,theline,fulnam); (* read note key *) if readnumber then brnotenumber(thefile,theline,note) else brnote(thefile,theline,note) end end; (* end module book.brheader version = 7.56; {of delmod.p 2000 Nov 21} *) (* begin module book.copyheader *) procedure copyheader(fromhea: header; var tohea: header); (* copy the header fromhea into tohea. Note that the linked objects are NOT copied, but merely pointed to. *) begin tohea.keynam.letters := fromhea.keynam.letters; tohea.keynam.length := fromhea.keynam.length; tohea.note := fromhea.note; tohea.fulnam := fromhea.fulnam; end; (* end module book.copyheader version = 7.56; {of delmod.p 2000 Nov 21} *) (* begin module book.brpiekey *) procedure brpiekey(var thefile: text; var theline: integer; var pie: piekey); (* read piece key, track the line number *) begin with pie do begin brheader(thefile,theline,hea); brreanum(thefile,theline,mapbeg); brconfig(thefile,theline,coocon); brdirect(thefile,theline,coodir); brnumber(thefile,theline,coobeg); brnumber(thefile,theline,cooend); brconfig(thefile,theline,piecon); brdirect(thefile,theline,piedir); brnumber(thefile,theline,piebeg); brnumber(thefile,theline,pieend); end end; (* end module book.brpiekey version = 7.56; {of delmod.p 2000 Nov 21} *) (* begin module book.brdna *) procedure brdna(var thefile: text; var theline: integer; var dna: dnaptr); (* read in dna from thefile, track the line *) (* note: if the dna were circularized, by linking the last dnastring to the first, then the cleardna routine could not clear properly, and would loop forever... there is no reason to do that, since a simple mod function will allow one to access the circle. *) var ch: char; workdna: dnaptr; begin getdna(dna); workdna:=dna; ch:=getto(thefile,theline,['d']); readln(thefile); theline := succ(theline); read(thefile,ch); (* skipstar *) while (ch = '*') do begin read(thefile,ch); (* skip blank *) repeat read(thefile,ch); if ch in ['a','c','g','t'] then begin if workdna^.length=dnamax then begin getdna(workdna^.next); workdna:=workdna^.next end; workdna^.length:=succ(workdna^.length); workdna^.part[workdna^.length]:=chartobase(ch) end until eoln(thefile); readln(thefile); (* go to next line *) theline := succ(theline); read(thefile,ch); (* ch is either '*' or 'd' *) end; readln(thefile); (* read past the d *) theline := succ(theline); end; (* end module book.brdna version = 7.56; {of delmod.p 2000 Nov 21} *) (* begin module book.brpiece *) procedure brpiece(var thefile: text; var theline: integer; var pie: pieceptr); (* read in a piece, change theline to reflect the lines traversed *) begin { readln(thefile); (* move past the word 'piece' - new definition 1999 Mar 13 *) theline := succ(theline); (* BUG: was below! *) bbb} brpiekey(thefile,theline,pie^.key); if numbered or (not skipunnum) then brdna(thefile,theline,pie^.dna); readln(thefile); (* move past the word 'piece' - new definition 1999 Mar 13 *) theline := succ(theline); end; (* end module book.brpiece version = 7.56; {of delmod.p 2000 Nov 21} *) (* begin module book.brinit *) procedure brinit(var book: text; var theline: integer); (* check that the book is ok to read, and set up the global variables for br routines *) begin (* brinit *) (* halt if the book is bad (first word is 'halt') or the first character is not * *) reset(book); if not eof(book) then begin (* check for the date line *) if book^ <> '*' then begin if book^ <> 'h' then writeln(output, ' this is not the first line of a book:') else writeln(output, ' bad book:'); write(output, ' '); while not (eoln(book) or eof(book)) do begin write(output, book^); get(book) end; writeln(output); halt end end else begin writeln(output, ' book is empty'); halt end; (* initialize free storage *) freeline:=nil; freedna:=nil; readnumber:=true; (* usually we read in numbers for items *) number:=0; (* arbitrary value *) numbered:=false; (* the piece has no number (none yet read in) *) skipunnum:=false; theline := 1; end; (* brinit *) (* end module book.brinit version = 7.56; {of delmod.p 2000 Nov 21} *) (* ************************************************************************ *) (* end module package.brpiece version = 7.56; {of delmod.p 2000 Nov 21} *) (* begin module book.getpiece *) procedure getpiece(var thefile: text; var theline: integer; var pie: pieceptr); (* move to and read in the next piece in the book *) var ch: char; begin ch:=getto(thefile,theline,['p']); (* get to the next p(iece) in the book *) if ch<>' ' then begin brpiece(thefile,theline,pie); { 1999 june 2: removed this: ch:=getto(thefile,theline,['p']); (* read to end of p *) } { bbb - now done in brpiece readln(thefile); (* read past piece *) theline := succ(theline); } end else clearpiece(pie); end; (* end module book.getpiece version = 7.56; {of delmod.p 2000 Nov 21} *) (* ************************************************************************ *) (* end module package.getpiece version = 7.56; {of delmod.p 2000 Nov 21} *) (* begin module findblank *) procedure findblank(var afile: text); (* read a file to find the next blank character *) var ch: char; begin repeat read(afile,ch) until ch = ' ' end; (* end module findblank version = 7.56; {of delmod.p 2000 Nov 21} *) (* begin module findnonblank *) procedure findnonblank(var afile: text; var ch: char); (* find the next non blank character in a file, return it in ch. *) begin ch:=' '; while (not eof(afile)) and (ch = ' ') do begin read(afile,ch); if eoln(afile) then readln(afile) end end; (* end module findnonblank version = 7.56; {of delmod.p 2000 Nov 21} *) (* begin module align.align *) procedure align(var inst, book: text; var theline: integer; var pie: pieceptr; var length, alignedbase: integer); (* documentation on align is in module info.align and delman.use.aligned.books. 1996 Sep 12: The routine now uses the trigger functions found in prgmod. The bug in the oldalign routine (that it misses the end of comments that end in a series of astrisks) has been fixed. It now checks that the piece corresponds to the book. *) const maximumrange = 10000; (* if the alignment point is more than this distance from the piece ends, the program halts in an attempt to catch the alignment bug... 1991 Jan 11 It appears that the rewrite of the code has removed the bug, but the check will be kept. *) semicolon = ';'; (* end of delila instruction *) var ch: char; (* a character in inst *) p: integer; (* index to a piece name *) p1: integer; (* another index to a piece name *) done: boolean; (* done finding an aligning get *) thebase: integer; (* the base read in *) indefault: boolean; (* true when within a default statement. These can contain the word 'piece', which must be ignored. *) gettrigger: trigger; (* trigger to find 'get' *) defaulttrigger: trigger; (* trigger to find 'default' *) nametrigger: trigger; (* trigger to find 'name' *) piecetrigger: trigger; (* trigger to find 'piece' *) settrigger: trigger; (* trigger to find 'set' *) begincomment: trigger; (* trigger to find '(-*' (ignore the dash!) *) endcomment: trigger; (* trigger to find '*-)' (ignore the dash!) *) begincurly: trigger; (* trigger to find comments: '{' *) endcurly: trigger; (* trigger to find comments: '}' *) quote1trigger: trigger; (* trigger to find single quote ' *) quote2trigger: trigger; (* trigger to find double quote " *) { procedure rd(var f: text; var ch: char); (* read ch from f allowing inspection of the result *) begin read(f,ch); write(output,ch); write(list,ch); write(output,'<',ch,'>'); end; procedure rdln(var f: text); (* readln f allowing inspection of the result *) begin readln(f); writeln(output); writeln(list); end; } procedure skipcomment(var f: text); (* skip an entire comment *) var comment: boolean; (* true means we are inside a comment *) begin (* skip to end of comment *) resettrigger(endcomment); comment := true; while comment do begin if eof(f) then begin writeln(output,'A comment does not end!'); halt end; if eoln(f) then readln(f) { rdln(f) } else begin {write(output,'<'); rd(f,ch); write(output,'>');} read(f,ch); testfortrigger(ch, endcomment); if endcomment.found then comment := false; end end end; procedure skipcurly(var f: text); (* skip an entire comment made by {}*) var comment: boolean; (* true means we are inside a comment *) begin (* skip to end of comment *) resettrigger(endcurly); comment := true; while comment do begin if eof(f) then begin writeln(output,'A comment does not end!'); halt end; if eoln(f) then readln(f) { rdln(f) } else begin {write(output,'<'); rd(f,ch); write(output,'>');} read(f,ch); testfortrigger(ch, endcurly); if endcurly.found then comment := false; end end end; procedure skipquote(quote: trigger); (* skip an entire quote of either the ' or " persuasion *) var kind: char; (* the kind of quote, ' or " *) begin kind := quote.seek.letters[1]; {writeln(output,'skipquote ',kind);} repeat findnonblank(inst,ch); (* get to the quote *) until (ch = kind) or eof(inst); if ch <> kind then begin writeln(output,'end of quote starting with ',kind,' not found'); halt; end; end; begin filltrigger(defaulttrigger,'default'); filltrigger(gettrigger,'get '); filltrigger(nametrigger,'name '); filltrigger(piecetrigger,'piece '); filltrigger(settrigger,'set '); filltrigger(begincomment,'(* '); filltrigger(endcomment,'*) '); filltrigger(begincurly,'{ '); filltrigger(endcurly,'} '); filltrigger(quote1trigger,''' '); filltrigger(quote2trigger,'" '); resettrigger(defaulttrigger); resettrigger(gettrigger); resettrigger(nametrigger); resettrigger(piecetrigger); resettrigger(settrigger); resettrigger(begincomment); resettrigger(begincurly); resettrigger(quote1trigger); resettrigger(quote2trigger); indefault := false; if not eof(book) then begin (* if there is still more to the book ... *) getpiece(book,theline,pie); (* read in the piece *) if not eof(book) then begin (* if we found a piece ... *) length:=pietoint(pie^.key.pieend,pie); (* calculate piece length *) (* now find in inst the next occurance of 'get' *) done := false; while not done do begin if eof(inst) then begin (* no instructions? *) alignedbase := 1; (* simply align by the first base *) done := true end else begin if eoln(inst) then readln(inst) {then rdln(inst)} else begin {rd(inst,ch);} read(inst,ch); testfortrigger(ch, begincomment); testfortrigger(ch, begincurly); if begincomment.found or begincurly.found then begin if ch = '*' then begin skipcomment(inst); resettrigger(begincomment); end else begin resettrigger(begincurly); skipcurly(inst); end end else begin (* we are not inside a comment *) testfortrigger(ch, gettrigger); if gettrigger.found then begin findnonblank(inst,ch); (* get to "from" *) findblank(inst); (* get past "from" *) read(inst,thebase); (* read in the alignedbase *) {writeln(output);writeln(output,'thebase = ',thebase:1);} alignedbase:=pietoint(thebase,pie); {writeln(output,'alignedbase=',alignedbase:1);} done := true end; testfortrigger(ch, quote1trigger); if quote1trigger.found then begin skipquote(quote1trigger); end; testfortrigger(ch, quote2trigger); if quote2trigger.found then begin skipquote(quote2trigger); end; testfortrigger(ch, defaulttrigger); if defaulttrigger.found then begin indefault := true; resettrigger(defaulttrigger) end; if ch = semicolon then indefault := false; testfortrigger(ch, settrigger); if settrigger.found then begin indefault := true; resettrigger(settrigger) end; if ch = semicolon then indefault := false; (* check that piece names are correct *) testfortrigger(ch, piecetrigger); if not indefault then if piecetrigger.found then begin skipblanks(inst); (* get to name *) with pie^.key.hea.keynam do begin for p := 1 to length do begin read(inst,ch); if letters[p] <> ch then begin writeln(output,'The piece name in the book: '); writeln(output,letters:length); writeln(output,'does not match', ' the inst file name:'); (* write the letters that matched: *) for p1 := 1 to p-1 do write(output,letters[p]); (* write the offending letter: *) write(output, ch); (* get the rest of the name and show it: *) done := eoln(inst); while not done do begin done := eoln(inst); if not done then begin read(inst,ch); if (ch = ' ') or (ch = ';') then done := true; if not done then write(output,ch); end; end; writeln(output); (* mark the first letter that does not match: *) for p1 := 1 to p-1 do write(output,' '); write(output,'^'); writeln(output); halt end; end end; end; end end end end; if (alignedbase <= -maximumrange) or (alignedbase > length + maximumrange) then begin writeln(output,' In procedure align:'); writeln(output,' read in base was ',thebase:1); writeln(output,' in internal coordinates: ',alignedbase:1); writeln(output,' maximum range was ',maximumrange:1); writeln(output,' piece length was ',length:1); with pie^.key.hea.keynam do writeln(output,' piece name: ',letters:length); writeln(output,' piece number: ',number:1); writeln(output,' aligned base is too far away... see the code'); halt end end end end; (* end module align.align version = 7.56; {of delmod.p 2000 Nov 21} *) (* ************************************************************************ *) (* end module package.align version = 7.56; {of delmod.p 2000 Nov 21} *) (* begin module flfill *) procedure flfill (var h, dh, ddh: fltable; n: integer); (* fills the array h with -f*log(f) for f = i/n, i running from 0 to n; fills the array dh with h[i+1]-h[i], ddh with h[i+2]-h[i] *) var freq, (* frequency *) nreal, (* real value of n *) ln2: real; (* ln(2) *) i: integer; (* loop counter *) begin h[0] := 0.0; ln2 := ln(2); nreal := n; for i := 1 to n do begin freq := i/nreal; h[i] := -freq * ln(freq)/ln2; dh[i-1] := h[i] - h[i-1]; if i>1 then ddh[i-2] := h[i] - h[i-2]; end; end; (* end module flfill *) (* begin module shift.random.31 *) procedure random(var rand: real; var iseed: integer); (* This random number generator is based on a shift register with a single bit of feedback, as described in Electronics for Neurobiologists, by Brown, Maxfield and Moraff, MIT press 1973, referencing Random Process Simulation and Measurement by Korn, McGraw-Hill 1966. A 31-bit shift register is maintained in the integer iseed, which should initially be given any positive value. This 31-bit number is shifted right one bit and the output of the last (31st) bit and the 13th bit are added modulo 2 (exclusive orred) and fed back into the new first bit. This is done between 4 and 11 times, depending on the last 3 bits of the original number. The result is converted to a real number between 0 and 1 and returned as the value of rand. The 31-bit shift register goes through all 2**31-1 values before repeating; the repetition frequency of this algorithm could be less or greater depending on the seed, because of the random number of multiple shifts per call. *) const pow18=262144; pow19=524288; pow30=1073741824; (* powers of 2 *) pow31m=2147483647.0; (* 2**31-1 *) var i, nrep: integer; (* index, number of times to do shift *) begin (* random *) nrep := 4 + iseed mod 8; (* do it 4 to 11 times based on last 3 bits *) for i:= 1 to nrep do (* if last bit and 9th bit are equal, feed back a 0, otherwise a 1 *) if( odd(iseed) = ((iseed mod pow19) >= pow18)) then iseed := iseed div 2 else iseed := (iseed div 2) + pow30; rand := iseed/pow31m; end; (* random *) (* end module shift.random.31 *) (* begin module randbase *) procedure randbase (var nuc: base; var iseed: integer); (* generate a random base, with p=0.25 for each base *) begin random (rand, iseed); if rand<0.25 then nuc:=a else begin if rand<0.5 then nuc:=c else begin if rand<0.75 then nuc:=g else nuc:=t; end; end; end; (* end module randbase *) (* begin module readparam *) procedure readparam(var pin: text); (* read and check parameters from parameter file pin *) begin reset(pin); readln(pin, winleft, winright); readln(pin, shiftmin, shiftmax); readln(pin, iseedparam); readln(pin, nranseq); readln(pin, nshuffle); readln(pin, ifpaired); readln(pin, standout); readln(pin, npassout); readln(pin, nshiftout); readln(pin, tolerance); readln(pin, ntolpass); if not eof(pin) then begin readln(pin, alignmenttype); if not (alignmenttype in ['f','i','b']) then begin writeln(output,'alignment type must be f, b, or i'); halt end; end else alignmenttype := 'i'; window := winright+1 - winleft; (* window must be >0 and < maxlen but can be anywhere *) if (window<=0) or (window>=maxlen) then begin write(output, 'parameter error: '); writeln(output, 'window is',window,', must be between 1 and',maxlen-1); halt; end; if (shiftmin>0) or (shiftmax<0) then begin write(output, 'parameter error: '); writeln(output, 'shiftmin must be < or = 0, shiftmax must be > or = 0'); halt; end; iseed := iseedparam; iseed2 := iseed; if iseed<=0 then begin write(output, 'parameter error: '); writeln(output, 'random seed must be > 0'); halt; end; paired := (ifpaired>0); (* convert ifpaired to boolean *) if (tolerance<=0.0) or (ntolpass<=0) then begin write(output, 'parameter error: '); writeln(output, 'tolerance and # of passes below tolerance must be > 0'); halt; end; end; (* end module readparam *) (* begin module writeparam *) procedure writeparam(var fout: text); (* writes standard header of user parameters to an output file *) begin rewrite(fout); (* initialize file *) writeln(fout, '* malign',version:5:2); (* program name and version *) writeln(fout,'*'); reset(book); (* copy first line of book *) copyaline(book, fout); reset(book); writeln(fout,'*'); writeln(fout, '* user specified parameters:'); writeln(fout,'* ',winleft:5, winright:5, ' window for calculating uncertainty, relative to aligned base'); writeln(fout,'* ',shiftmin:5, shiftmax:5, ' minimum and maximum shift of aligned base'); writeln(fout,'* ',iseedparam, ' random seed'); writeln(fout,'* ',nranseq:6, ' number of random sequences (0 for sequences in book)'); writeln(fout,'* ',nshuffle:6, ' number of runs after random shuffle'); writeln(fout,'* ',ifpaired:6, ' independent sequences (0), or pairs of complementary sequences (1)'); writeln(fout,'* ',standout:6, ' no (-1), limited (0) or full (1) standard output'); writeln(fout,'* ',npassout:6, ' period at which to output H and alignment'); writeln(fout,'* ',nshiftout:6,' period at which to output L and H(L)'); writeln(fout,'* ',tolerance:10:6,' tolerance in change of H'); writeln(fout,'* ',ntolpass:6, ' maximum number of passes below tolerance'); writeln(fout,'*'); end; (* end module writeparam *) (* begin module readaligned *) procedure readaligned(var inst, book: text); (* read aligned sequences from book and inst files, place in linked list *) var pie: pieceptr; (* standard pointer to piece *) commonshift, (* common limit on shifting of paired sequences *) length, (* length of piece *) alignedbase, (* relative number of aligned base *) almax, (* a maximum alignment *) i: integer; (* array index *) begin reset(book); (* reset files *) reset(inst); new(pie); (* create space for pieces *) numseq := 0; (* zero # of sequences *) while not eof(book) do begin case alignmenttype of 'i': align(inst, book, theline, pie, length, alignedbase); 'b','f': begin getpiece(book, theline, pie); (* read in the piece *) length := piecelength(pie); alignedbase := -inttopie(1, pie); end; end; if not eof(book) then begin (* I assume there's no sequence if eof *) numseq := numseq +1; (* increment sequence count *) if numseq>maxnseq then begin writeln(output,'procedure readaligned error:'); writeln(output,'number of sequences greater than limit of ', maxnseq:1); halt; end; if length>maxlen then begin writeln(output,'procedure readaligned error:'); writeln(output,'sequence ',numseq,', length', length, ', greater than limit of',maxlen); halt; end; new(sep); (* create new space *) if numseq = 1 then sepfirst := sep (* set up first pointer *) else seplast^.next := sep; (* or link from last record *) for i := 1 to length do (* transfer bases *) sep^.alseq[i] := pie^.dna^.part[i]; sep^.length := length; (* transfer the name from pie into the data structure *) sep^.piecename.length := pie^.key.hea.keynam.length; for i := 1 to sep^.piecename.length do sep^.piecename.letters[i] := pie^.key.hea.keynam.letters[i]; sep^.alignread := alignedbase; sep^.alignstart := alignedbase; sep^.aligncurrent := alignedbase; sep^.alignmin := alignedbase+shiftmin; sep^.alignmax := alignedbase+shiftmax; if alignmenttype <> 'b' then begin almax := length - winright; (* if sep^.alignmax > almax then writeln(output,'modify alignmax!') else writeln(output,'max nope!'); if sep^.alignmin < (1-winleft) then writeln(output,'modify alignmin!') else writeln(output,'min nope!'); *) (* desired minimum alignment; may not be lower than 1-winleft *) if sep^.alignmin < (1-winleft) then sep^.alignmin := 1-winleft; (* desired maximum alignment; may not be higher than almax *) almax := length - winright; if sep^.alignmax > almax then sep^.alignmax := almax; end; if (sep^.alignmaxalignedbase) then begin writeln(output,'procedure readaligned error:'); writeln(output,'In sequence ',numseq:1 , ', the aligned base is too close to one end:'); if (sep^.alignmaxalignedbase) then writeln(output,'sep^.alignmin>alignedbase'); writeln(output,'alignedbase = ',alignedbase:1); writeln(output,'shiftmin = ',shiftmin:3); writeln(output,'shiftmax = ',shiftmax:3); writeln(output,'winleft = ',winleft:3); writeln(output,'winright = ',winright:3); writeln(output,'sep^.alignmin = alignedbase+shiftmin = ', sep^.alignmin:1); writeln(output,'sep^.alignmax = alignedbase+shiftmax = ', sep^.alignmax:1); if sep^.alignmin <> alignedbase + shiftmin then begin writeln(output,'EXCEPT that sep^.alignmin < (1-winleft)'); writeln(output,'SO sep^.alignmin = 1-winleft'); writeln(output,'WHERE winleft = ',winleft:1); end; halt; end; (* if reading second sequence of pair, make shifts mutually limiting *) if paired and (not odd(numseq)) then begin (* calculate minimum of allowed shift of last to left and this one to right, impose that as limit on both shifts *) commonshift := seplast^.alignread-seplast^.alignmin; if commonshift > (sep^.alignmax-alignedbase) then commonshift := sep^.alignmax-alignedbase; seplast^.alignmin := seplast^.alignread - commonshift; sep^.alignmax := alignedbase + commonshift; (* calculate minimum of allowed shift of last to right and this one to left, impose that as limit on both shifts *) commonshift := seplast^.alignmax-seplast^.alignread; if commonshift > (alignedbase- sep^.alignmin) then commonshift := alignedbase-sep^.alignmin; seplast^.alignmax := seplast^.alignread + commonshift; sep^.alignmin := alignedbase - commonshift; end; seplast := sep; (* save pointer to put in link on next round *) end; end; (* end of while loop searching through book *) sep^.next := nil; if numseq = 0 then begin writeln(output,'no sequences found in the book'); halt; end; if paired and odd(numseq) then begin writeln(output,'since the sequences should be paired, there should'); writeln(output,'be an odd number of them. There are ',numseq:1,'.'); halt; end; dispose(pie); end; (* end module readaligned *) (* begin module genrandseqs *) procedure genrandseqs; (* generates random sequences and puts them into linked list *) var seqno, i, (* indices *) len: integer; (* length of sequences *) begin numseq := nranseq; (* number of sequences *) len := 1+(winright-winleft) + (shiftmax - shiftmin); for seqno := 1 to numseq do begin new(sep); (* create new space *) if seqno = 1 then sepfirst := sep (* set up first pointer *) else seplast^.next := sep; (* or link from last record *) for i := 1 to len do randbase(sep^.alseq[i], iseed); sep^.length := len; sep^.alignmin := 1-winleft; sep^.alignread := sep^.alignmin-shiftmin; sep^.alignmax := sep^.alignread +shiftmax; sep^.alignstart := sep^.alignread; sep^.aligncurrent := sep^.alignread; seplast := sep; (* save pointer to put in link on next round *) end; sep^.next := nil; end; (* end module genrandseqs *) (* begin module fillnbl *) procedure fillnbl; (* computes the n(B,L) array from the linked list of sequences *) var b: base; (* temporary for base *) i, (* array index *) seqno, (* sequence counter *) offset: integer; (* offset into sequence *) begin sep := sepfirst; (* initialize pointer *) for b := a to t do (* zero the matrix *) for i := 1 to window do nbl[b,i] := 0; for seqno := 1 to numseq do begin offset := sep^.aligncurrent+winleft-1; (* offset to get this sequence in the window *) for i := 1 to window do begin b := sep^.alseq[i + offset]; (* base at this position *) nbl[b,i] := nbl[b,i] + 1; (* increment matrix entry *) end; sep := sep^.next; (* point to next sequence *) end; end; (* end module fillnbl *) (* begin module hcalc *) procedure hcalc(var nbl: matrix; var flogf: fltable; var hl: poslist; var htot: real; window: integer); (* calculates H(L) and total H from n(B,L) matrix, using flogf table *) var i: integer; (* index to positions *) b: base; (* index to bases *) temp: real; (* a temporary real (what else?) *) begin htot := 0; (* zero total *) for i := 1 to window do begin temp := 0; (* add up the flogf's in the ith column *) for b := a to t do temp := temp + flogf[nbl[b,i]]; htot := htot + temp; (* add to grand total *) hl[i] := temp; end; end; (* end module hcalc *) (* begin module changenbl *) procedure changenbl(var sep: seqrecptr; winlen, increment: integer); (* subtracts or adds sequence pointed to by sep to the nbl array, up to the length specified by winlen *) var i, offset: integer; (* index, offset into sequence for given alignment *) b: base; (* temporary base *) begin with sep^ do begin offset := aligncurrent+winleft-1; (* offset into sequence *) for i := 1 to winlen do begin b := alseq[i+offset]; (* base at this window position *) nbl[b,i] := nbl[b,i]+increment; (* change nbl for this base *) end; end; end; (* end module changenbl *) (* begin module shiftseq *) procedure shiftseq; (* shift sequence between allowed alignments and find alignment with minimum H value *) var alatmin: array[1..maxlen] of integer; (* alignments with minimum dh *) dh, (* current value of dh for particular alignment *) dhcur, (* dh for current alignment *) dhmin: real; (* running minimum dh value *) numbermin, (* number of minimum dh's hit *) alcur, (* working alignment *) i, offset: integer; (* index, offset into sequence for given alignment *) (* b: base; (@ temporary base *) begin with sep^ do begin (* subtract off the sequence from the nbl array *) changenbl(sep, window, -1); dhmin := 1.0e10; (* run through each allowed alignment calculating dh *) for alcur := alignmin to alignmax do begin dh:= 0.0; (* accumulate dh here *) offset := alcur +winleft -1; (* this is the core of the entire program, determine if the uncertainty h would be lower with this alignment, by summing the differences from the current h. That is, calculate dh. *) for i := 1 to window do dh:= dh+ fldiff[nbl[alseq[i+offset],i]]; (* save dh if we are at the current alignment this saves us the trouble of calculating it separately *) if alcur = aligncurrent then dhcur := dh; if dh<=dhmin then begin (* if at or below minimum *) if dh 1 then begin (* resolve ties for minimum if they exist *) random(rand,iseed2); (* ie make numbermin be index to randomly selected alignment on list *) numbermin := trunc(0.99999+(numbermin*rand)); if numbermin = 0 then numbermin := 1; (* writeln(output,'See there really are ties! (shiftseq)'); *) end; if alatmin[numbermin] = aligncurrent (* if no change in alignment *) then notchanged := notchanged +1 (* it's true of one more sequence *) else begin notchanged := 0; (* otherwise zero count of unchanged sequences *) hcurrent := hcurrent + (dhmin-dhcur); (* adjust current h value *) end; aligncurrent := alatmin[numbermin]; (* add the sequence back to the nbl array at new alignment*) changenbl(sep, window, 1); end; end; (* end module shiftseq *) (* begin module doubleshift *) procedure doubleshift; (* shift sequence between allowed alignments and find alignment with minimum H value, for paired complementary sequences *) var alatmin: array[1..maxlen] of integer; (* alignments with minimum dh *) dh, (* current value of dh for particular alignment *) dhcol, (* dh for one column *) dhcur, (* dh for current alignment *) dhmin: real; (* running minimum dh value *) numbermin, (* number of minimum dh's hit *) alcur, (* working alignment *) halfwindow, (* size of window actually being calculated for *) offsetnex, (* offset into next sequence *) i, offset: integer; (* index, offset into sequence for given alignment *) b, bn: base; (* base in this and next sequence *) nxp: seqrecptr; (* pointer to paired sequence *) begin halfwindow := (window+1) div 2; (* length of unique part of window *) nxp := sep^.next; (* point to next sequence *) (* subtract off the sequences from the nbl array *) (* NOTE WELL: the right half of nbl goes to pot during this process *) changenbl(sep, halfwindow, -1); changenbl(nxp, halfwindow, -1); dhmin := 1.0e10; (* run through each allowed alignment calculating dh *) for alcur := sep^.alignmin to sep^.alignmax do begin dh:= 0.0; (* accumulate dh here *) offset := alcur +winleft -1; offsetnex := (nxp^.aligncurrent+sep^.aligncurrent-alcur)+winleft-1; for i := 1 to halfwindow do begin b := sep^.alseq[i+offset]; bn := nxp^.alseq[i+offsetnex]; (* if bases are equal dh for the column is fldoubl value, otherwise it's the sum of fldiff's for the two bases *) if b=bn then dhcol := fldoubl[nbl[b,i]] else dhcol := fldiff[nbl[b,i]] + fldiff[nbl[bn,i]]; dh:= dh+ dhcol; end; (* dh is twice this for the whole window, minus dh for the last column for an odd window *) if odd(window) then dh := dh+dh-dhcol else dh := dh+dh; (* save dh if it's the current alignment *) if alcur = sep^.aligncurrent then dhcur := dh; if dh<=dhmin then begin (* if at or below minimum *) if dh 1 then begin (* resolve ties for minimum if they exist *) random(rand,iseed2); (* ie make numbermin be index to randomly selected alignment on list *) numbermin := trunc(0.99999+(numbermin*rand)); if numbermin = 0 then numbermin := 1; (* writeln(output,'See there really are ties! (doubleshift)'); *) end; if alatmin[numbermin] = sep^.aligncurrent (* if no change in alignment *) then notchanged := notchanged +2 (* it's true of two more sequences *) else begin notchanged := 0; (* otherwise zero count of unchanged sequences *) hcurrent := hcurrent + (dhmin-dhcur); (* adjust current h value *) end; sep^.aligncurrent := alatmin[numbermin]; nxp^.aligncurrent := nxp^.alignread+sep^.alignread-sep^.aligncurrent; (* add the sequences back to the nbl array at new alignment*) changenbl(sep, halfwindow, +1); changenbl(nxp, halfwindow, +1); end; (* end module doubleshift *) (* begin module hloutput *) procedure hloutput (var fout:text; npass, shiftno: integer); (* output uncertainty as a function of position, H(L), for pass npass and shift number shiftno *) (* modificiation for xyplo program format: all data are in columns *) var i: integer; (* index to positions *) begin for i := 1 to window do begin (* pass number, shift number *) write (fout, ' ',npass:5, ' ',shiftno:5); (* position L, Hs(L) *) writeln(fout,' ',(winleft+i-1):3,' ',hl[i]:10:6); end end; (* end module hloutput *) (* begin module alignoutput *) procedure alignoutput (var fout:text; npass: integer); (* outputs current H, pass number npass, and alignments *) var seqno: integer; (* index to sequences *) begin sep := sepfirst; writeln(fout, 'pass', npass:6,', H =',hcurrent:12:7, ' relative alignments:'); for seqno := 1 to numseq do begin write(fout, sep^.aligncurrent-sep^.alignread:4); sep := sep^.next; if (seqno mod 20) = 0 then writeln(fout); end; if(numseq mod 20) <> 0 then writeln(fout); end; (* end module alignoutput *) (* begin module albestout *) procedure albestout(var fout: text; oap: optlistptr; numperline, field: integer); (* outputs the array oap^.albest, numperline per line, field width = field *) var seqno: integer; (* index to sequences *) begin for seqno := 1 to numseq do begin write(fout, oap^.albest[seqno]:field); if(seqno mod numperline)=0 then writeln(fout); end; if (numseq mod numperline) <>0 then writeln(fout); end; (* end module albestout *) (* begin module instoutput *) procedure instoutput(var fout: text; oap: optlistptr); (* outputs a new inst file for alignment pointed to by oap*) var seqno: integer; (* index to sequences *) i: integer; (* index to each piece name *) thesign: integer; (* -1 or +1, defining the orientation of the Delila instruction *) function sign(i: integer): char; begin if i >= 0 then sign := '+' else sign := '-' end; begin rewrite(fout); writeln(fout,'title "malign ',version:4:2,'";'); writeln(fout,'(* begin module numbering *)'); writeln(fout,'(* number only the pieces, starting at 1 *)'); writeln(fout,'default numbering piece;'); writeln(fout,'default numbering 1;'); writeln(fout,'default out-of-range reduce-range;'); writeln(fout,'(* end module numbering *)'); writeln(fout,'(* data on this alignment:'); writeln(fout,'The H value: ', oap^.hbest:infofield:infodecim); writeln(fout,'Number of times achieved: ',oap^.num:1); writeln(fout,'*)'); writeln(fout); writeln(fout,'organism org;'); writeln(fout,'chromosome chr;'); sep := sepfirst; thesign := +1; (* if not paired, sign is always +1 *) for seqno := 1 to numseq do begin write(fout,'piece '); for i := 1 to sep^.piecename.length do write(fout,sep^.piecename.letters[i]); sep := sep^.next; write(fout,';'); writeln(fout,' (* piece ',seqno:1,' *)'); (* writeln(fout,'get from', oap^.albest[seqno]:10,' -x', ' to ', oap^.albest[seqno]:10,' +y;'); *) if paired and (not odd(seqno)) then thesign := -1 else thesign := +1; writeln(fout,'get from', oap^.albest[seqno]:10,' ', sign(thesign*winleft),abs(winleft):1, ' to ', 'same' ,' ', sign(thesign*winright),abs(winright):1,';') (* old method: before 'same' command: ' to ', oap^.albest[seqno]:10,' ', sign(thesign*winright),abs(winright):1,';') *) end; end; (* end module instoutput *) (* begin module optalignout *) procedure optalignout(var fout: text); (* outputs relative alignments of the set of optimal alignments in a format usable to the user *) var optno, (* counter of optimal alignments *) seqno: integer; (* index to sequences *) begin writeparam(fout); (* initialize, write params to file *) writeln(fout, '* relative aligned bases for the set of optimal alignments'); writeln(fout); writeln(fout, numseq:5,' sequences,',numopt:5,' optimal alignments in', shuffle:6,' runs'); writeln(fout, horiginal:12:7,' = H for original alignment'); oap := oapfirst; for optno := 1 to numopt do begin (* do each optimal alignment in turn *) writeln(fout); (* write blank line then n and H *) writeln(fout,optno:4,')',oap^.num:6,' occurrences, H =', oap^.hbest:12:7, ', relative aligned bases:'); sep := sepfirst; (* run through the sequences computing relative alignments as optimal alignment minus original alignment *) for seqno := 1 to numseq do begin write(fout, oap^.albest[seqno]-sep^.alignread:4); if(seqno mod 20)=0 then writeln(fout); sep := sep^.next; end; if (numseq mod 20) <>0 then writeln(fout); oap := oap^.next; end; end; (* end module optalignout *) (* begin module optinstout *) procedure optinstout(var fout: text); (* outputs optimal alignments in absolute DNA coordinates for conversion to new inst files later *) (* should use inttopie routines: does it? *) var seqno: integer; (* index to sequences *) begin rewrite(fout); (* initialize file *) writeln(fout,numseq,' ',numopt); (* first line: # of sequences, aligns *) oap := oapfirst; repeat (* for each optimal alignment *) writeln(fout,oap^.num:5,' ',oap^.hbest:12:7); (* write num and H *) for seqno := 1 to numseq do begin write(fout, ' ',oap^.albest[seqno]:8); (* these are absolute now! *) if (seqno mod 10) = 0 then writeln(fout); end; if(numseq mod 10) <> 0 then writeln(fout); oap := oap^.next; until oap = nil; end; (* end module optinstout *) (* begin module optoutput *) procedure optoutput; (* calls procedure to output optimal alignments in readable relative form, then converts all optimal alignments to absolute DNA coordinates and calls procedures to output them *) var seqno: integer; (* index to sequences *) pie: pieceptr; (* pointer for piece *) length, alignedbase: integer; (* for call to align only *) { oapprevious: optlistptr; (* the previous alignment *)} begin optalignout(optalign); (* output readable relative optimal alignments *) reset(book); (* prepare to read book and inst again *) reset(inst); new(pie); for seqno := 1 to numseq do begin (* read each sequence in turn *) case alignmenttype of 'i': align(inst, book, theline, pie, length, alignedbase); 'b','f': begin getpiece(book, theline, pie); (* read in the piece *) length := piecelength(pie); alignedbase := -inttopie(1, pie); end; end; oap := oapfirst; (* then for each optimal alignment, convert the internal alignment for that sequence to absolute DNA coordinate *) repeat oap^.albest[seqno] := inttopie(oap^.albest[seqno],pie); oap := oap^.next; until oap = nil; end; optinstout(optinst); (* output file of absolute alignments *) { instoutput(bestinst, oapfirst); (* file of new inst for best alignment *) } end; (* end module optoutput *) (* begin module calehnb *) procedure calehnb(n: integer; gna,gnc,gng,gnt: integer; var hg, ehnb, varhnb: real (* ; debugging: boolean *)); (* calculate e(hnb) in bits/bp (ehnb) for a number (n) of example sequence sites. gna to gnt are the composition to use for the genome probabilities of a to t. the genomic entropy hg and the variance var(hnb) (=varhnb) are also calculated. if the variable debugging is passed to the procedure then the individual combinations of hnb are displayed. note: this procedure should not be broken into smaller procedures so that it remains efficient. version = 3.02; of procedure calehnb 1983 nov 23 *) const maxsize = 200; (* the largest n allowed *) accuracy = 10000; (* less than (1/accuracy) bits error is demanded for the sum of pnb (see variable 'total') at the end of the procedure *) var log2: real; (* natural log of 2, used to find log base 2 *) logn: real; (* log of n *) nlog2: real; (* n * log2 *) gn: integer; (* sum of gna..gnt *) logpa,logpc,logpg,logpt: real; (* logs of genome probabilities *) (* log of n factorial is the sum of i=1 to n of log(i). the array below represents these logs up to n *) logfact: array[0..maxsize] of real; (* precalculated values of -p*log2(p), where p=nb/n for nb = 0 .. n. m stands for minus *) mplog2p: array[0..maxsize] of real; i: integer; (* index for logfact and mplog2p *) logi: real; (* natural log of i *) na, nc, ng, nt: integer; (* numbers of bases in a site *) done: boolean; (* true when the loop is completed *) pnb: real; (* multinomial probability of a combination of na, nc, ng, nt *) hnb: real; (* entropy for a combination of na..nt *) pnbhnb: real; (* pnb*hnb, an intermediate result *) sshnb: real; (* sum of squares of hnb *) (* variables for testing program correctness: *) total: real; (* sum of pnb over all combinations of na..nt if this is not 1.00, the program is in error *) counter: integer; (* counts the number of times through the loop *) begin (* calehnb *) (* prevent access to outside the arrays: *) if n > maxsize then begin writeln(output,' procedure calehnb: n > maxsize (', n:1,'>',maxsize:1,')'); halt end; counter := 0; total := 0.0; log2 := ln(2); logn := ln(n); nlog2 := n * log2; (* get logs of genome probabilities *) gn := gna + gnc + gng + gnt; logpa := ln(gna/gn); logpc := ln(gnc/gn); logpg := ln(gng/gn); logpt := ln(gnt/gn); (* find genomic entropy *) hg := -(gna*logpa + gnc*logpc + gng*logpg + gnt*logpt)/(gn*log2); ehnb := 0.0; (* start error entropy at zero *) sshnb := 0.0; (* make table of log of n factorial up to n and entropies for nb/n *) logfact[0] := 0.0; (* factorial(0) = 0 *) mplog2p[0] := 0.0; for i := 1 to n do begin logi := ln(i); logfact[i] := logfact[i - 1] + logi; mplog2p[i] := - i * (logi - logn) / nlog2 end; (* begin by looking at the combination with all a: na = n *) na := n; nc := 0; ng := 0; nt := 0; (* the following loop simulates a number of nested loops of the form: for b1=a to t do for b2=b1 to t do for b3=b2 to t do ... for bn=b(n-1) to t do ... the resulting set of variables increase in alphabetic order since no inner loop variable can have a value less than any outer loop. the number of times through the inner-most loop is given by: o = (n + 1)*(n + 2)*(n + 3)/6 in the case where there are four symbols (a,c,g,t) and n is the number of nested loops. a recursive set of loops would be possible, but it would use up too much memory in practical cases (up to n=150 or higher). a second algorithm sequests the loop variables into an array and increments them there. however, the goal is to get all possible combinations for na, nc, ng, nt, where the sum of these is n. the nested loops provide all the combinations in alphabetic order, assuring that there can not be any duplicates. to find nb (one of na..nt) one would look at which of the variables b1 to bn were of value b. this is a wasteful operation. the loop below simulates the array of control variables by changing each nb directly. *) done := false; repeat (* pnb is calculated by taking the log of the expression fact(n) na nc ng nt pnb = ------------------- pa * pc * pg * pt . fact(na).. fact(nt) log(pnb) generates a series of sums, allowing the calculation to proceed by addition and multiplication rather than multiplication and exponentiation. the factorials become tractable in this way *) pnb := exp(logfact[n] (* n factorial *) - logfact[na] - logfact[nc] - logfact[ng] - logfact[nt] + na * logpa + nc * logpc + ng * logpg + nt * logpt); hnb := mplog2p[na] + mplog2p[nc] + mplog2p[ng] + mplog2p[nt]; pnbhnb := pnb * hnb; ehnb := ehnb + pnbhnb; sshnb := sshnb + pnbhnb * hnb; (* sum of squares of hnb *) (* the following section keeps track of the calculation and writes out the current set of nb. *) counter := succ(counter); (* if debugging then begin write(output,' ',counter:2,' '); for i := 1 to na do write(output,'a'); for i := 1 to nc do write(output,'c'); for i := 1 to ng do write(output,'g'); for i := 1 to nt do write(output,'t'); write(output,' ',na:3,nc:3,ng:3,nt:3); writeln(output,' pnb = ',pnb:10:5); end; *) total := total + pnb; (* the remaining portion of this repeat loop generates the values of na, nc, ng and nt. notice that there are 7 possibilities at each loop increment. other than the stop, in each case the sum of na+nc+ng+nt remains constant (=n). *) if nt > 0 then begin (* ending on a t - do outer loops *) if ng > 0 then begin (* turn g into t *) ng := ng - 1; nt := nt + 1 end else if nc > 0 then begin (* turn one c into g, and all t to g (note ng = 0 initially) *) nc := nc - 1; ng := nt + 1; nt := 0 end else if na > 0 then begin (* turn one a into c and all g and t to c. (note ng=nc=0 initially) *) na := na - 1; nc := nt + 1; nt := 0 end else done := true (* since nt = n *) end else begin (* no t - increment innermost loop *) if ng > 0 then begin (* turn g into t *) ng := ng - 1; nt := nt + 1 end else if nc > 0 then begin (* turn c into g *) nc := nc - 1; ng := ng + 1 end else begin (* na > 0; turn a into c *) na := na - 1; nc := nc + 1 end end until done; (* final adjustment: we only have the sum of squares so far *) varhnb := sshnb - ehnb*ehnb; (* if this message appears, there is either a bug in the code or the computer cannot be as accurate as requested *) if accuracy <> round(accuracy * total) then begin writeln(output,' procedure calehnb: the sum of probabilities is'); writeln(output,' not accurate to one part in ',accuracy:1); writeln(output,' the sum of the probabilities is ',total:10:8); end; (* if this message appear, then there is an error in the repeat-until loop: it did not repeat as many times as is expected from the algorithm *) if counter <> round((n+1)*(n+2)*(n+3)/6) then begin writeln(output,' procedure calehnb: program error, the number of'); writeln(output,' calculations is in error'); halt end; (* writeln(output, ' total: ',total:10:5); writeln(output,' count = ',counter:1); writeln(output,' (n+1)*(n+2)*(n+3)/6 = ', round((n+1)*(n+2)*(n+3)/6):1); *) end; (* calehnb *) (* end module calehnb version = 5.35; (@ of rseq.p 1995 Feb 21 *) (* begin module calaehnb *) procedure calaehnb(n: integer; gna,gnc,gng,gnt: integer; var hg, aehnb, avarhnb: real); (* calculate ae(hnb) in bits/bp (=aehnb) for a number (n) of example sequence sites. gna to gnt are the composition to use for the genome probabilities of a to t. the genomic entropy (=hg) and the variance avar(hnb) (=avarhnb) are also calculated. this procedure gives approximations for e(hnb) and var(hnb). it is based on a formula derived by jeff haemer. see also: g. p. basharin theory probability appl. 4(3): 333-336 (1959) 'on a statistical estimate for the entropy of a sequence of independent random variables' version = 3.01; of procedure calaehnb 1983 nov 23 *) var log2: real; (* natural log of 2 *) gn: integer; (* sum of gna..gnt *) pa, pc, pg, pt: real; (* genomic probabilities *) e: real; (* the approximate sampling error *) begin (* calaehnb *) log2 := ln(2); gn := gna + gnc + gng + gnt; pa := gna/gn; pc := gnc/gn; pg := gng/gn; pt := gnt/gn; hg := -( (pa*ln(pa)) +(pc*ln(pc)) +(pg*ln(pg)) +(pt*ln(pt)))/log2; e := 3/(2*log2*n); aehnb := hg - e; avarhnb := e * e end; (* calaehnb *) (* end module calaehnb version = 5.35; (@ of rseq.p 1995 Feb 21 *) (* begin module xyoutput *) procedure xyoutput(var malignxyin: text); (* produce the malignxyin file *) var Hbefore: real; (* Hbefore for calculating information content *) rank: integer; (* ranking of the alignment *) Ehnb: real; (* small sample correction: 2 - e(n) *) gna,gnc,gng,gnt: integer; (* genomic composition *) hg: real; (* genomic uncertainty *) varhnb: real; (* var(hnb) *) begin rewrite(malignxyin); writeln(malignxyin,'* malign',version:5:2); writeln(malignxyin,'* columns definitions:'); writeln(malignxyin,'* 1: rank: from 1 to the number of alignment classes'); writeln(malignxyin,'* 2: occurrences: how many times the class was found'); writeln(malignxyin,'* 3: H: the uncertainty of the alignment, in bits'); writeln(malignxyin,'* 4: R: the information content of the alignment, in bits'); oap := oapfirst; rank := 0; gna := 1000; gnc := 1000; gng := 1000; gnt := 1000; (* compute sample size correction for numseq *) if numseq <= kickover then begin (* not using approximation *) calehnb (numseq, gna,gnc,gng,gnt, hg, Ehnb, varhnb); end else begin (* using approximation *) calaehnb(numseq, gna,gnc,gng,gnt, hg, Ehnb, varhnb); end; Hbefore := Ehnb * (winright - winleft + 1); repeat rank := succ(rank); write(malignxyin,' ',rank:10); write(malignxyin,' ',oap^.num:10); write(malignxyin,' ',oap^.hbest:infofield:infodecim); write(malignxyin,' ',(Hbefore - oap^.hbest):infofield:infodecim); writeln(malignxyin); oap := oap^.next; until oap = nil; end; (* end module xyoutput *) (* begin module realign *) procedure realign; (* shifts the window on all sequences so that as many sequences as possible keep their original alignment *) var alhist: array[1..maxchange] of integer; (* histogram of align changes *) histmax, (* maximum value in histogram *) binmax, (* bin in histogram with max value *) bin, (* index to bins *) alshift, (* alignment shift temporary value *) alshiftmin, alshiftmax: integer; (* min and max allowed grand shifts *) begin for bin := 1 to maxchange do alhist[bin] := 0; alshiftmin := -10000; (* get min and max possible changes *) alshiftmax := 10000; sep := sepfirst; repeat (* form a histogram of changes from original alignment *) bin := maxchange div 2 + sep^.alignread - sep^.aligncurrent; if (bin>0) and (bin<=maxchange) then alhist[bin] := alhist[bin]+1; alshift := sep^.alignmin-sep^.aligncurrent; if alshift>alshiftmin then alshiftmin := alshift; alshift := sep^.alignmax-sep^.aligncurrent; if alshifthistmax) then begin histmax := alhist[bin]; binmax := bin; end; if alhist[binmax]>minmaxforchange then begin globshift := binmax-maxchange div 2; (* convert to alignment shift *) if globshift>alshiftmax then globshift := alshiftmax; if globshift0) and (sep<>nil) do begin sep^.aligncurrent:= sep^.aligncurrent+globshift; sep := sep^.next; end; end; end; (* end module realign *) (* begin module findbestalignment *) procedure findbestalignment; (* does repeated passes through the set of sequences until "convergence" *) var shiftno, (* shift number *) npass: integer; (* number of passes *) htemp: real; (* temporary h value *) ifhlout: boolean; (* flag to do H(L) output this run *) dohlout: boolean; (* flag to do H(L) output this shift *) begin ifhlout := (shuffle>nshuffle) and (nshiftout>=0); (* do H(L) output if this is the last run and nshiftout >= 0 *) if ifhlout then begin (* writeparam(uncert); (@ initialize and write params to file *) writeln(uncert, '* Position, L, and uncertainty, H(L), as the alignment improves'); writeln(uncert, '*'); writeln(uncert, '* ',window, ' positions'); writeln(uncert,'* pass number, shift number, position L, H(L)'); hloutput(uncert, 0, 0); (* output starting H(L) *) end; if npassout>=0 then begin (* if outputing new alignments *) writeln(newalign); (* blank line *) writeln(newalign, 'run number:', shuffle:6,', original random seed:', iseedsave:15); alignoutput(newalign, 0); (* output starting alignments *) end; notchanged := 0; (* # of consecutive sequences with no change *) intolerance := 0; (* # of passes with change in H less than tolerance *) npass := 0; repeat npass := npass +1; (* increment pass number *) hpass := hcurrent; (* save h at beginning of pass *) sep := sepfirst; shiftno := 0; repeat (* shift sequences until all done or no change in one pass *) shiftno := shiftno+1; (* increment shift number *) if paired then begin (* for pairs, do shift every other time *) if odd(shiftno) then doubleshift; end else shiftseq; sep := sep^.next; (* if doing H(L) output, do it if at the end of a pass of (or?) if nshiftout shifts have been done *) if ifhlout then begin dohlout := (shiftno=numseq); if nshiftout > 0 then dohlout := dohlout or ((shiftno mod nshiftout) = 0); if dohlout then begin if paired then fillnbl; (* fix nbl if doing paired *) hcalc(nbl, flogf, hl, htemp, window); (* get H and H(L) *) hloutput(uncert, npass, shiftno); end; end; until (sep=nil) or ((notchanged>numseq)and(globshift=0)); (* terminate in the middle of a pass only if the last realignment attempt made no global shift of window on sequences *) if (hpass-hcurrent)0 then writeln(output,shuffle:6, npass:6, hcurrent:13:7); if npassout>0 then if (npass mod npassout) = 0 then alignoutput(newalign, npass); until (intolerance>ntolpass) or (notchanged>=numseq); if standout=0 then writeln(output,shuffle:6, npass:6, hcurrent:13:7); (* 2005 Feb 7: TDS. The following code finally crashed because mod of a negative value is undefined. Duh. Follow the definition!!! Geepers. if npassout=0 then alignoutput(newalign, npass) else if (npass mod npassout) <> 0 then alignoutput(newalign, npass); *) if npassout=0 then alignoutput(newalign, npass) else if npassout > 0 then begin if (npass mod npassout) <> 0 then alignoutput(newalign, npass); end; end; (* end module findbestalignment *) (* begin module randomalign *) procedure randomalign; (* generates a new random starting alignment *) var altrunc, (* randomly selected value with range of alignments *) alrange: integer; (* range of allowed alignments *) begin sep := sepfirst; repeat random(rand,iseed); alrange := sep^.alignmax-sep^.alignmin; (* range of alignments *) altrunc := trunc(rand*(alrange+1)); if(altrunc>alrange) then altrunc := alrange; sep^.alignstart := sep^.alignmin + altrunc; sep^.aligncurrent := sep^.alignstart; sep := sep^.next; if paired then begin (* if paired adjust next sequence by reverse *) sep^.alignstart := sep^.alignmax-altrunc; sep^.aligncurrent := sep^.alignstart; sep := sep^.next; end; until sep=nil; end; (* end module randomalign *) (* begin module optcheckadd *) procedure optcheckadd; (* checks if current best alignment is on list of optimal alignments; if so, increments count for that alignment; if not, adds it to list *) var match, (* flag if match existing one on list *) termloop: boolean; (* flag to terminate loop *) seqno: integer; (* index to sequences *) begin match := false; (* flag for match to existing ones on list *) termloop := false; (* flag to terminate loop *) oap := oapfirst; (* initialize to go through list *) oaplast := nil; (* keep this pointing to last record *) (* go through list until there's a match or until oap points to first alignment with h greater than hcurrent *) if oap<>nil then if hcurrent>=oap^.hbest then repeat if hcurrent = oap^.hbest then begin (* if h's match then *) match := true; (* it's a provisional match *) sep := sepfirst; seqno := 1; (* run through alignments until one doesn't match *) while match and (seqno<=numseq) do begin if oap^.albest[seqno]<>sep^.aligncurrent then match := false; seqno := seqno+1; sep := sep^.next; end; (* if still match after check, increment number *) if match then oap^.num := oap^.num+1; end; oaplast := oap; oap := oap^.next; if oap=nil then termloop := true else if hcurrent=0 then begin writeparam(newalign); (* write params to alignment file *) writeln(newalign, '* relative alignments at start, end of each run', ' and during run if npassout>0'); end; if standout>=0 then writeln(output,' run pass uncertainty'); shuffle := 0; oapfirst := nil; (* pointer to first entry of list of optimal aligns *) numopt := 0; (* number of optimal alignments *) iseedsave := iseed; repeat shuffle := shuffle +1; fillnbl; (* fill the nbl array for the current alignment *) hcalc(nbl, flogf, hl, hcurrent, window); (* calculate H and H(L) *) if shuffle=1 then horiginal := hcurrent; (* save original h *) findbestalignment; optcheckadd; (* add alignment to list if it's unique new one *) iseedsave := iseed; randomalign; until shuffle > nshuffle; optoutput; (* output files associated with optimum alignments *) xyoutput(malignxyin); 1: end.