program search(book, searchinst, result, input, searchfeatures, output); (* search: search a book for strings by Thomas Schneider, modified by Gary Stormo some concepts from Jon McCabe and Stephen O'Haire Thomas D. Schneider, Ph.D. National Institutes of Health National Cancer Institute Gene Regulation and Chromosome Biology Laboratory Molecular Information Theory Group Frederick, Maryland 21702-1201 schneidt@mail.nih.gov toms@alum.mit.edu (permanent) http://alum.mit.edu/www/toms (permanent) module libraries: delman, delmods, prgmods *) label 1; (* end of program *) const (* begin module version *) version = 6.95; (* of search.p 2011 May 08 2011 May 08, 6.95: bug: org/chr missing 2011 Apr 05, 6.94: create proper link for demo.colors.search.jpg 2010 Nov 25, 6.93: remove debug 'dofeatures ====='; update address 2008 Apr 21, 6.92: first base of mutation counting is zero of feature 2008 Apr 21, 6.91: duplication removal by lister when mutations identical 2008 Apr 21, 6.90: cleanup dofeatures 2008 Apr 21, 6.88: hoining dofeatures 2008 Apr 21, 6.87: negparts need adjusting ... done? 2008 Apr 21, 6.86: negparts need adjusting 2008 Apr 21, 6.85: posparts and negparts need adjusting 2008 Apr 21, 6.84: located the bug, fixing ... in dofeatures 2008 Apr 21, 6.83: search string inversion bug 2008 Apr 19, 6.82: avoid infinite loop when bad command - quit! 2008 Apr 16, 6.81: clean up 2008 Apr 16, 6.80: R and I commands 2006 May 09, 6.78: fix bug: "name" was ""name"" from procedure display at "name the piece into the delila instructions" 2005 Sep 15, 6.77: Infinite loop if no final 'q' command! This is hard to solve because the program needs to work both interactively and with 'search < searchp'. Recorded as a known bug. 2004 Sep 8, 6.76: fix bug in getcolorbackground (wrong call for newTparam) 2004 Aug 25, 6.75: searchp example built, delila subsystem takes comments 2004 Aug 5, 6.74: demo.colors.search.jpg 2004 Aug 5, 6.73: demo.colors.search directory (as tarball) 2004 Jul 21, 6.72: implement petal height control; document C command 2004 Jul 21, 6.71: implement petal height control; document C command 2004 Jul 18, 6.70: B command features written properly 2004 Jul 18, 6.69: B command reads ok. 2004 Jul 18, 6.68: module upgrades completed; new B and C commands 2004 Jul 18, 6.67: spelling; begin color named objects in searchfeatures 6.66 2002 Aug 28: add to wish list - Delila format mutations 6.65 2001 Sep 9: bug in ascii feature placement when complement: featureinserts 6.64 2001 Sep 7: work on spiechange 6.63 2001 Sep 7: fix bug: complement should accept (/) symbols 6.62 2001 Aug 23: variables for both book and searchinst (not debugged). 6.61 2000 Nov 6: set dnamax to 10,000,000 for speed (it had been reset) 6.60 2000 Jun 16: spell improve, doc upgrade 6.59 2000 Jun 26: absorb upgrades to delmod 6.57 2000 Jun 3: allow [ and ] in search patterns 6.50 1999 Dec 15: named searches go into searchinst as name "whatever"; 6.49 1999 Dec 13: delmod/y2k upgrade 6.44 1999 June 3: mark mismatches on features 6.42 1999 April 29: type 3 instructions 6.38 1999 April 28: delila instructions use 'same', fixed and in delmod 6.33 1999 April 8: delila instructions use 'same' 6.30 1999 April 7: "A" command resets objects to be arrows 6.29 1998 June 24: inst file renamed searchinst so as not to kill previous inst!! 6.25 1998 Jan 4: upgrade dnamax to 10 million base sequences for search of genomes 6.24 1997 Oct 10: strings made 2000 characters long 6.16 1997 May 8: relationship uses $ now, not ^ 6.12 1997 May 7: upgrade to searchfeatures origin before 1983 *) (* end module version *) (* begin module describe.search *) (* name search: search a book for strings synopsis search(book: in, searchinst: out, result: out, input: intty, searchfeatures: out, output: out) files book: any book from the Delila system searchinst: Delila instructions of the form 'get from 56 -5 to same +5;' that define the location of found strings. One must turn on printing to the searchinst file to obtain these (see below). If there are instructions with names inside double quotes, then these will be put out as Delila name instructions. See the searchfeatures file; this is turned on at the same time. See examples. result: a transcript of the results seen on the output file. Lines not containing numerical data begin with an '*' so that they can be ignored by other programs such as genhis and xyplo. input: typed input from the user, or a file of rules. searchfeatures: features for the lister program. To start the file, simply provide a name inside double quotes (eg "EcoRI"). Subsequent searches (eg gaattc) will be labeled with that name. To turn off the features, use an empty quote string, as "". The searchfeatures file can be concatenated with other features to create the features file for lister. output: messages, results and prompts to the user. description (note: in the following examples, do not type the quote marks.) the search program allows one to look for simple patterns in a book. the patterns can be like 'ggag', that is, with particular bases (always written 5' to 3') or it can include unknown 'spacing' bases, as in 'ggagnnnnnnnnnatg'. any base will be allowed in the n positions. one can shorten the instruction: 'ggag9natg', and one can make some of the spacing 'extentable' as in 'ggag5e4natg' which allows a 5 to 9 spacing between the two elements. one can obtain Delila instructions for the strings found by turning on printing, setting 'from' and 'to' values and searching. for example: 'd p f -5 t +10 q gga6e3n#atg' sets up printing, with from=-5, to=+10. the search will result in instructions for strings centered on the a of the atg (by the # symbol). the form '(a/g)ct' means to search for both 'act' and 'gct'. you may specify numbers of mismatches, and control how much is printed. you can type many commands on one line, separated by spaces. you can also search for relations between bases. currently the allowed relations are: identity, non-identity, complementarity and non-complementarity. see delman.use.search or type 'help' while inside the program to get more information. NOTE: Many commands now are capital letters to avoid confusion between commands. See the help function (H, ?) for details. 2004 July 21: There is a new command, B, which defines colors on seach features as displayed by the lister program. examples If one is working with an odd binding site (one with an odd number of bases) one should use the # symbol to obtain Delila instructions. The complement sequence will continue to number the central base. gaa#nttc complemented becomes gaa#nttc If one is working with an even binding site (one with an even number of bases) one should use the % symbol to obtain Delila instructions. The complement sequence will continue to number the following base. ga%attc complemented becomes ga#attc The program is pretty smart about writing the Delila instructions. If one searches for the complementary sequence, the instructions are automatically written to extract the complementary pattern found. Thus if one searches for #gtt in ex0bk (the example book file), there is one found in the positive direction of the fragment. Then if one takes the complement with the "~" command, one is searching for aa#c. Two of these are located in the piece. The instructions are written so that the gtt's all line up, as is easily checked by extracting the fragments with delila and looking with alist. To create searchfeatures, define the name of a search string by typing the name inside quotes (as: "EcoRI") and then search. Vertical bars or carets (| or ^) in the search string (as: g|aattc) will carry over to the feature. If you have search instructions: D from -200 to +200 q "aceB" agttatcaagtatttttaattaaaatggaaattgtttttgattttgcattttaaatgagtagtcttagtt#n q then the resulting Delila instructions in searchinst will look like: organism E.coli; chromosome E.coli; piece U00096; name "aceB"; get from 4212981 -200 to same +200 direction +; documentation delman.use.search see also {An example search parameter, searchp file:} searchp {A search parameter file for most restriction enzymes:} enzyme {Program to create input DNA sequences:} delila.p {Example book for input:} ex0bk {Program that takes the bookand the scan features as input to create a map of the DNA sequence:} lister.p {Example colors:} demo.colors.search.jpg {Example of colored boxes in search results:} demo-colors-search.zip {A second colored box example:} search-bar-color.zip author Thomas D. Schneider, modified by Gary Stormo bugs There is overlap between the letters used as commands to the program and letters used as ambiguous bases. For instance, h can mean (a/c/t) or it can mean 'help'. The best way to avoid confusion is to always start search strings with either a,c,g,t,n or (. Warning: if you use a file for input, be sure that the rules include a quit command and have no errors in them. It is possible that errors will lead to an infinite loop, though this has never been observed. (This may be a general problem with interactive i/o in pascal on your computer.) The searchfeatures only work with rigid strings since only the first definition will be accepted by lister. It is not clear how to handle variable sizes (like gat3etag). A search for "incorrect.symmetry" cc#gg will be located correctly, but following that by ~ = (to get the complement and search again) will not give a correct display. Using cc%gg will because the % matches the symmetry of the site. Likewise, "ok" tc#nga ~ = "not.ok" tc%nga ~ = It is not yet clear whether the user can be protected against this. The variables orgchange, chrchange and piechange do not work properly. Probably they should be done for both the book being read AND for the delila instructions being written. HOWEVER it seems that since the book has a certain structure, the output instructions can follow it to some extent. 1999 June 2: It would be nice to record mismatches on the feature, but this would require changing the definition for every found piece! 2002 Aug 28: add to wish list - Delila format mutations --- * piece: U24170, #1, configuration: linear, direction: +, begin: 3158, end: 3238 * "atcctgggaatttctgggaa" "agactgggcatgtctgggca" " xx x x x " 5 mismatche(s) ^ 3194 * --- Have search spit out the "with"-type Delila instructions for these. 2005 Sep 15: The program will go into an infinite loop if one calls it non-interactively like this: search < searchp if there is no final 'q' command. It is not clear how to solve this because interactive input relys on detecting the eof. So just make sure that your searchp files end with 'q'! *) (* end module describe.search *) (* no longer pointed to: demo.colors.search.tar.Z {(See untarball in the toolkit,} http://www.lecb.ncifcrf.gov/~toms/toolkit.html {for unpackaging the tar file.)} *) (**************************************************** * programming note * search uses a period to end search strings rather * than the string length. this is a historical * artifact that must be lived with until a more * advanced search is written (preferably based on * a bnf). *****************************************************) (* more constants: *) (* BEGIN module interact.const *) (* lock in place for larger strings ... *) maxstring = 2000; (* the maximum string *) (* END module interact.const version = 'prgmod 3.96 85 mar 18 tds'; *) maxquotestring = 2000; (* maximum length of a string inside "" *) answersmax = 10; (* maximum number of times to try to get an answer from input. If the input is a file, we NEVER will get an answer and go into an infinite loop. To avoid that, count the number of answers. If it exceeds this constant, the program stops. *) (* LOCK begin module book.const *) (* constants needed for book manipulations *) dnamax = 10000000; (* length of dna arrays *) namelength = 100; (* maximum key name length *) linelength = 80; (* maximum line readable in book *) (* LOCK end module book.const version = 7.47; {of delmod.p 2000 June 26} *) (* begin module datetime.const *) datetimearraylength = 19; (* length of dataarray for dates, It is just long enough to include the 4 digit year - solving the year 2000 problem: 1980/06/09 18:49:11 123456789 123456789 1 2 *) (* end module datetime.const version = 7.64; {of delmod.p 2004 Jul 18} *) (* begin module info.const *) infofield = 10; (* size of field for printing information in bits *) infodecim = 6; (* number of decimal places for printing information *) (* these are used for conlist only *) nfield = 8; (* size of field for printing n, the number of sites *) (* end module info.const version = 4.73; (@ of prgmod.p 2004 Jul 22 *) (* begin module ribl.const *) minribl = -2000; (* lowest ribl matrix from allowed *) maxribl = +2000; (* highest ribl matrix to allowed *) defnegativeinfinity = -1000; (* default for negative infinity for the Ri(b,l) table *) (* end module ribl.const version = 4.73; (@ of prgmod.p 2004 Jul 22 *) type (* begin module datetime.type *) (* array for dates *) datetimearray = packed array[1..datetimearraylength] of char; (* end module datetime.type version = 7.64; {of delmod.p 2004 Jul 18} *) (* begin module book.type *) (* types needed for book manipulations *) chset = set of 'a'..'z'; (* types defined in book definition *) alpha = packed array[1..namelength] of char; (* this is not alfa *) (* name is a left justified string with blanks following the characters *) name = record letters: alpha; length: 0..namelength (* zero means an unspecified structure *) end; lineptr = ^line; line = record (* a line of characters *) letters: packed array [1..linelength] of char; length: 0..linelength; next: lineptr end; direction = (plus, minus, dircomplement, dirhomologous); configuration = (linear, circular); state = (on, off); header = record (* header of key *) keynam: name; (* key name of structure *) fulnam: lineptr; (* full name of structure *) note: lineptr (* note key *) end; (* begin module base.type *) (* define the four nucleotide bases *) base = (a,c,g,t); (* end module base.type version = 7.64; {of delmod.p 2004 Jul 18} *) (* sequence types *) dnaptr = ^dnastring; dnarange = 0..dnamax; seq = packed array[1..dnamax] of base; dnastring = record part: seq; length: dnarange; next: dnaptr end; orgkey = record (* organism key *) hea: header; mapunit: lineptr (* genetic map units *) end; chrkey = record (* chromosome key *) hea: header; mapbeg: real; (* number of genetic map beginning *) mapend: real (* number of genetic map ending *) end; pieceptr = ^piece; piekey = record (* piece key *) hea: header; mapbeg: real; (* genetic map beginning *) coocon: configuration; (* configruation (circular/linear) *) coodir: direction; (* direction (+/-) relative to genetic map *) coobeg: integer; (* beginning nucleotide *) cooend: integer; (* ending nucleotide *) piecon: configuration; (* configruation (circular/linear) *) piedir: direction; (* direction (+/-) relative to coordinates *) piebeg: integer; (* beginning nucleotide *) pieend: integer; (* ending nucleotide *) end; piece = record key: piekey; dna: dnaptr end; reference = record pienam : name; (* name of piece referred to *) mapbeg : real; (* genetic map beginning *) refdir : direction; (* direction relative to coordinates *) refbeg : integer; (* beginning nucleotide *) refend : integer; (* ending nucleotide *) end; genkey = record (* gene key *) hea : header; ref : reference; end; trakey = record (* transcript key *) hea : header; ref : reference; end; markerptr = ^marker; markey = record (* marker key *) hea : header; ref : reference; sta : state; phenotype : lineptr; next : markerptr; end; marker = record key : markey; dna : dnaptr; end; (* end module book.type version = 7.64; {of delmod.p 2004 Jul 18} *) (* begin module interact.type *) (* begin module string.type *) stringptr = ^string; (* pointer to a string *) string = record (* a string of characters *) letters: array[1..maxstring] of char; (* the letters in the string *) length: integer; (* the number of characters in the string *) current: integer; (* the letter we are working on *) next: stringptr; (* the next string in a series *) end; (* end module string.type version = 4.73; (@ of prgmod.p 2004 Jul 22 *) (* end module interact.type version = 4.73; (@ of prgmod.p 2004 Jul 22 *) { ribltypeptr = integer; (* dummy to satisfy compiler NO GOOD!!!! *) } (* begin module wave.type *) waveptr = ^waveparam; (* to link several wave definitions together *) waveparam = record (* parameters to define a cosine wave *) (* define a cosine wave: *) extreme: char; (* h or l, the high or low extreme to be defined *) wavelocation: real; (* the location in bases of the extreme *) wavebit: real; (* the location in bits of the extreme *) waveamplitude: real; (* the amplitude of the wave in bits *) wavelength: real; (* the wave length of the wave in bases *) { 2000 Nov 1. This is difficult because the length of a curve is not simply multiplied by a scale factor. BASEdashon: real; (* dashon interval in bases *) BASEdashoff: real; (* dashon interval in bases *) BASEdashoffset: real; (* dashon interval in bases *) } dashon: real; (* the size of on dashes in cm. dashon <= 0 means no dashes *) dashoff: real; (* the size of on dashes in cm *) dashoffset: real; (* the size of off dashes in cm *) thickness: real; (* thickness of the wave in cm. <= 0 means default *) next: waveptr; (* the next wave *) end; (* end module wave.type version = 4.73; (@ of prgmod.p 2004 Jul 22 *) (* begin module scan.type *) (* define the ribl matrix. Source library is prgmod.p REQUIRES ribl.const module REQUIRES base.type or book.type module REQUIRES wave.type module for wave definition! *) rblarray = array[a..t, minribl..maxribl] of real; (* real(B,L) *) ribltype = record riblname: string; (* name of the weight matrix *) riblheader: stringptr; (* misc header information, starting with '*' *) data: rblarray; (* real(B,L) *) numbers: array[a..t, minribl..maxribl] of integer; (* n(b,l) *) frombase, tobase: integer; (* range of the matrix *) mean, stdev: real; (* mean and standard deviation of distribution *) consensus: real; (* Ri value of consensus sequence *) anticonsensus: real; (* Ri value of anticonsensus sequence *) averageRi: real; (* average Ri for random sequence *) n: integer; (* number of sequences used to create matrix *) symmetry: char; (* the symmetry of the Riblmatrix *) waves: waveptr; (* cosine wave definitions for the matrix *) cmperbase, cmperbit: real; (* required for wave dash definition *) Ribound: real; (* the Ri boundary for this definition *) Zbound: real; (* the Z boundary for this definition *) Pbound: real; (* the probability boundary for this definition *) end; ribltypeptr = ^ribltype; (* pointer to ribltype so it does not need to be created unless actually used *) (* end module scan.type version = 4.73; (@ of prgmod.p 2004 Jul 22 *) (* begin module definition.feature.type *) (* Features and their definitions for the lister program *) petaltype = record (* define parts of a colored rectangle around a walker *) el: integer; (* edgelinewidth: edge linewidth (integer) *) c : char; (* color kind: how color is defined: r for RGB, h for HSB *) (* ---------------------------------------------- *) eh: real; (* edgeh: edge hue OR red *) es: real; (* edges: edge saturation OR blue *) eb: real; (* edgeb: edge brightness OR green *) (* ---------------------------------------------- *) fh: real; (* fillh: fill hue OR red *) fs: real; (* fills: fill saturation OR blue *) fb: real; (* fillb: fill brightness OR green *) (* ---------------------------------------------- *) spare: real; (* spare variable *) end; definitiontypeptr = ^definetype; (* pointer to definetype *) definetype = record (* store a definition *) (* define "Site" "-" "" -7 -3.5 0 +3.0 +5 *) nametag: string; (* name of the feature *) background: string; (* background padding characters *) negparts: string; (* parts of the feature display *) posparts: string; (* parts of the feature display *) locations: array [1..maxstring] of real; (* locations of the marks of the feature *) (* ---------------------------- *) (* computed values: *) marks: integer; (* the number of marks used in this feature *) min: real; (* one end of the feature (minimum location) *) max: real; (* the other end of the feature (maximum location) *) number: integer; (* the number of the definition read in *) (*[[*) matrix: ribltypeptr; (* an ribl matrix if available *) (* The following boundaries are DIFFERENT from the originally defined boundaries of the matrix. This allows the matrix to keep its bounds (eg for default values for scanning AND it allows the lister program to define separate boundaries for displaying green versus red on the zero bar. *) RiboundFeature: real; (* the Ri boundary for this feature *) ZboundFeature: real; (* the Z boundary for this feature *) PboundFeature: real; (* the probability boundary for this feature *) petal: petaltype; (* color rectangle background *) (*]]*) next: definitiontypeptr; (* the next definition recorded *) end; (* ---------------------------- *) featuretypeptr = ^featuretype; (* pointer to featuretype *) featuretype = record (* store a feature *) (* @ K01789 270 +1 "Site" "Positive 270" @ K01789 270 -1 "Site" "Negative 270" @ K01789 280 +1 "Site" "Positive 280" [[ @ K01789 229.0 -1 "dnaA" "+12.2 bits " 12.200338 -0.473212 0.318031 ]] *) id: string; (* name of the sequence piece the feature is on *) coordinate: real; (* location of zero base *) orientation: integer; (* -1 or +1 is in direction of piece *) nametag: string; (* the name tag - name of the feature *) othertag: string; (* the other tag - another tag for misc use *) (* ---------------------------- *) definition: definitiontypeptr; (* the definition of the feature *) (*[[*) (* ---------------------------- *) (* the following three values are only defined when there is a definition for the feature matrix *) Ri: real; (* individual information of this site *) Z: real; (* Z score for this site *) probability: real; (* probability for this site *) (* Three parameters replace Ri, Z and p when there is no matrix, Aparam, Bparam and Cparam. If there is a matrix, Tparam will be blank. Otherwise: *) Tparam: char; (* a parameter that defines the kind of parameter that the remainder parameters are. *) Aparam: real; (* a parameter *) Bparam: real; (* a parameter *) Cparam: real; (* a parameter *) Dparam: real; (* a parameter *) (* Since these parameters are now (2004 July 17) able to substitute for Ri, Z and probability, the Tparam cannot be placed in front of the three parameters in feature files. Tparamvalues: h = hsb feature colors: hue, saturation, brightness r = rgb feature colors: red, green, blue b = bit range for the feature ' ' = defaults to sequence walker Summary: Tparam Aparam Bparam Cparam Dparam For ' ' Ri Z P (none) walker 'h' hue saturation brightness (none) ascii lines 'r' red green blue (none) ascii lines 'H' hue saturation brightness thickness color bar 'R' red green blue thickness color bar In this scheme one can control the color of the bar as an ascii string OR one can control the colored rectangle behind the bar but NOT BOTH. *) {zzz} (*]]*) (* ---------------------------- *) evencoordinate: real; (* location of zero base for asymmetric and odd symmetry sites, with 0.0 as the decimal. For even symmetry sites it's the point of symmetry, with 0.5 as the decimal. *) (* ---------------------------- *) (* computed values: *) unsatisfied: boolean; (* true when the feature has not yet been used during printing a line *) fromrange: real; (* the lower part of the feature *) torange: real; (* the higher part of the feature *) number: integer; (* the number of the feature read in *) desiredline: integer; (* The line the feature wants to be printed on. Zero means any value. Line increases down the page. *) (* ---------------------------- *) next: featuretypeptr; (* the next feature recorded *) end; (* end module definition.feature.type version = 4.73; (@ of prgmod.p 2004 Jul 22 *) (* for keeping track of related bases *) intarray = array[1..maxstring] of integer; var book, (* the book being searched *) searchinst, (* Delila instructions *) result, (* for hardcopy output *) searchfeatures: (* search features for lister program *) (* input, search instructions *) (* output, display to screen *) text; datetime: datetimearray; (* the date and time of this search *) buffer: string; (* a rule or typed line from input *) gotten: boolean; (* whether a token desired was obtained *) command: char; (* a user's command *) (* user settable varibles *) (* variables defined in viewhelp: *) viewt,viewe,viewi,viewf,views,viewp,viewd,viewm,viewb: boolean; viewnothing: boolean; (* a flag that the user is not viewing anything. if true, the user is prevented from doing a search for which no results will be shown *) mismatches: integer; (* maximum number of mismatches allowed *) printinginstructions: boolean; (* true means that when a pattern is found, instructions for getting to it in the library are printed into searchinst *) fromplace,toplace: integer; (* what to get around a found pattern #'d base (Delila print command) *) insttype: integer; (* instruction type. insttype=1 means the form get from p -/+f to same +/-t dir +/-; insttype=2 means the form get from p1 -/+f to p2 +/-t dir +/-; where p or p2 are the current location, p1 is the previous location. insttype=3 means the form get from p1 -/+f to p2 +/-t dir +/-; where p1 is the current location 5' end, p2 is the 3' end *) oktosearch: boolean; (* if true, searches are performed when the = command is given or when the pattern is typed. If false, searches are performed only when the = command is given *) firstinput: boolean; (* this variable helps the user the first time, when, under unix operating systems, the first line is ignored *) (* user defined search start point and shift between search steps: *) startpoint, shift: integer; ok: boolean; (* the pattern typed in was ok *) pattern, (* the pattern to search for *) exppattern, (* the pattern expanded *) lastpattern: (* the pattern previously searched for *) string; bookmatches: integer; (* total matches in the book by a pattern *) (* relatedbase is an array of integer that tells what position in the pattern this base is related to *) relatedbase: intarray; relational: boolean; (* true if there is a relation in the pattern *) flip: boolean; (* if true, reverse the direction of written Delila instructions. This is used when the fromposition is greater than the to position. *) reusethepiece: boolean; (* if true, don't read the book anymore because there is only one sequence in the book! This should speed up searches. *) (* variables for searchfeatures *) dosearchfeatures: boolean; (* whether to create the searchfeatures *) featuredefwritten: boolean; (* whether the current feature definition has been written to searchfeatures *) thedefinition: definitiontypeptr; (* the current definition *) thefeature: featuretypeptr; (* the current feature *) doarrow: boolean; (* the next feature will be an arrow *) featureinserts: boolean; (* inserts to the feature defined or not. For historical reasons symbols like # are inserted into the feature at the final match stage. But if one searches with a string and takes the complement, then they must NOT be inserted again during the second search. I suppose the same thing could happen with mismatches. So this boolean makes sure that the symbols are inserted only one time. *) poundsign: boolean; (* true if a # was used in the search string. Normally the search feature ends are just specified from the left edge. However, when a user requests #, it means that the feature is specified from the point given by the #. *) (* ooo *) (* 2001 Aug 23: I will DEFINE the following to be tracking the book state. See below for the new variables. *) orgchange, chrchange, piechange: boolean; (* that any changed *) orgopen, chropen, pieopen: boolean; (* used by getocp *) org: orgkey; (* the current organism *) chr: chrkey; (* the current chromosome *) pie: pieceptr; (* the current piece *) theline: integer; (* tracking line number in book *) (* 2001 Aug 23: these variables track the state of the searchinst *) sorgchange, schrchange, spiechange: boolean; (* that any changed *) sorgopen, schropen, spieopen: boolean; (* which are open *) patterncomplement: boolean; (* if false, then the pattern is as typed in. If true, then the pattern is the complement of that typed in. By keeping track of this, the orientation of the Delila instructions can be made correct. *) answers: integer; (* current number of answers to a question *) (* begin module book.var *) (* ************************************************************************ *) (* global variables needed for book manipulations *) (* free storage: *) freeline: lineptr; (* unused lines *) freedna: dnaptr; (* unused dnas *) readnumber: boolean; (* whether to read a number from the notes, or to read in the notes *) number: integer; (* the number of the item just read *) numbered: boolean; (* true when the item just read is numbered *) skipunnum: boolean; (* a control variable to allow skipping of un-numbered items in the book *) (* ************************************************************************ *) (* end module book.var version = 7.64; {of delmod.p 2004 Jul 18} *) (* procedure modules *****************************************************) (* begin module package.primitive *) (* ************************************************************************ *) (* begin module halt *) procedure halt; (* stop the program. the procedure performs a goto to the end of the program. you must have a label: label 1; declared, and also the end of the program must have this label: 1: end. examples are in the module libraries. this is the only goto in the delila system. *) begin writeln(output,' program halt.'); goto 1 end; (* end module halt version = 7.64; {of delmod.p 2004 Jul 18} *) (* begin module copyaline *) procedure copyaline(var fin, fout: text); (* copy a line from file fin to file fout *) begin (* copyaline *) while not eoln(fin) do begin fout^ := fin^; put(fout); get(fin) end; readln(fin); writeln(fout); end; (* copyaline *) (* end module copyaline version = 7.64; {of delmod.p 2004 Jul 18} *) (* begin module copylines *) function copylines(var fin, fout: text; n: integer): integer; (* copy n lines of file fin to file fout. the actual number of lines copied is returned. *) var index: integer; (* the current line number *) begin (* copylines *) index := 0; while (not eof(fin)) and (index < n) do begin copyaline(fin, fout); index := succ(index) end; copylines := index end; (* copylines *) (* end module copylines version = 7.64; {of delmod.p 2004 Jul 18} *) (* ************************************************************************ *) (* end module package.primitive version = 7.64; {of delmod.p 2004 Jul 18} *) (* begin module package.getocp *) (* ************************************************************************ *) (* begin module package.brpiece *) (* ************************************************************************ *) (* begin module book.basis *) (* procedures needed for book manipulations *) (* get procedures should be used for all linked lists of records *) procedure getline(var l: lineptr); (* obtain a line from the free line list or by making a new one *) begin if freeline<>nil then begin l:=freeline; freeline:=freeline^.next end else new(l); l^.length:=0; l^.next:=nil end; procedure getdna(var l: dnaptr); begin if freedna<>nil then begin l:=freedna; freedna:=freedna^.next end else new(l); l^.length:=0; l^.next:=nil end; (* clear procedures should be called each time the records are no longer needed failure to do this may result in a stack overflow. *) procedure clearline(var l: lineptr); (* return a line to the free line list *) var lptr: lineptr; begin if l<>nil then begin lptr:=l; l:=l^.next; lptr^.next:=freeline; freeline:=lptr end end; procedure writeline(var afile: text; l: lineptr; carriagereturn: boolean); (* write a line to a file, with carriage return if carriagereturn is true. *) var index: integer; (* index to characters in l *) begin with l^ do begin for index := 1 to length do write(afile, letters[index]); end; if carriagereturn then writeln(afile); end; procedure showfreedna; (* show the freedna list *) var counter: integer; (* count of freedna list *) l: dnaptr; (* pointer into freedna list *) begin l := freedna; counter := 0; while l <> nil do begin counter := succ(counter); write(output,counter:1); write(output, ', length = ',l^.length:1); { This is illegal according to gpc because one cannot write a pointer to a text file. It can be unearthed for debugging. write(output, ', pointer id: ',l:1); } writeln(output); l := l^.next end; end; procedure cleardna(var l: dnaptr); var lptr: dnaptr; begin if l<>nil then begin lptr:=l; l:=l^.next; lptr^.next:=freedna; freedna:=lptr end end; procedure clearheader(var h: header); (* clear the header h (remove lines to free storage) *) begin with h do begin clearline(fulnam); while note<>nil do clearline(note) end end; procedure clearpiece(var p: pieceptr); (* clear the dna of the piece *) begin while p^.dna<>nil do cleardna(p^.dna); clearheader(p^.key.hea) end; function chartobase(ch:char):base; (* convert a character into a base *) begin case ch of 'a': chartobase:=a; 'c': chartobase:=c; 'g': chartobase:=g; 't': chartobase:=t end end; function basetochar(ba:base):char; (* convert a base into a character *) begin case ba of a: basetochar:='a'; c: basetochar:='c'; g: basetochar:='g'; t: basetochar:='t'; end end; function complement(ba:base):base; (* take the complement of ba *) begin case ba of a: complement:=t; c: complement:=g; g: complement:=c; t: complement:=a; end end; function chomplement(b: char): char; (* create the character complement of base b. I must be getting hungry! *) begin chomplement := basetochar(complement(chartobase(b))); end; function pietoint(p: integer; pie: pieceptr): integer; (* p is a coordinate on the piece. we want to transform p into a number from 1 to n: an internal coordinate system for easy manipulation of piece coordinates *) (* Note: the dirhomologous and dircomplement are treated as plus and minus directions, which MIGHT NOT BE RIGHT! *) var i: integer; (* an intermediate value *) begin with pie^.key do begin case piedir of dirhomologous, plus: if p>=piebeg then i:=p-piebeg+1 else i:=(p-coobeg)+(cooend-piebeg)+2; dircomplement, minus: if p<=piebeg then i:=piebeg-p+1 else i:=(cooend-p)+(piebeg-coobeg)+2 end; pietoint:=i end end; function inttopie(i: integer; pie: pieceptr):integer; (* i is in the range 1 to some maximum. it is an internal coordinate system for the program. we want to do a coordinate transformation to obtain a value in the range of the piece called pie: i=1 corresponds to piebeg and i=its maximum corresponds to pieend *) (* Note: the dirhomologous and dircomplement are treated as plus and minus directions, which MIGHT NOT BE RIGHT! *) var p: integer; (* an intermediate value *) begin with pie^.key do begin case piedir of dirhomologous, plus: begin p:=piebeg+(i-1); if p>cooend then if coocon=circular then p:=p-(cooend-coobeg+1) end; dircomplement, minus: begin p:=piebeg-(i-1); if p '*' then begin writeln(output,' procedure skipstar: bad book'); writeln(output,' "*" expected as first character on the line, but "', thefile^,'" was found'); halt end; get(thefile); (* skip the star *) if thefile^ <> ' ' then begin writeln(output,' procedure skipstar: bad book'); writeln(output,' "* " expected on a line but "*', thefile^,'" was found'); halt end; get(thefile) (* skip the blank *) end end; (* skipstar *) (* end module book.skipstar version = 7.64; {of delmod.p 2004 Jul 18} *) (* begin module book.brreanum *) procedure brreanum(var thefile: text; var theline: integer; var reanum: real); (* read a real number from the file *) begin skipstar(thefile); readln(thefile,reanum); theline := succ(theline) end; (* end module book.brreanum version = 7.64; {of delmod.p 2004 Jul 18} *) (* begin module book.brnumber *) procedure brnumber(var thefile: text; var theline: integer; var num: integer); (* read a number from the file *) begin skipstar(thefile); readln(thefile,num); theline := succ(theline) end; (* end module book.brnumber version = 7.64; {of delmod.p 2004 Jul 18} *) (* begin module book.brname *) procedure brname(var thefile: text; var theline: integer; var nam: name); (* read a name from the file *) var i: integer; (* an index to the name *) c: char; (* a character read *) begin (* brname *) skipstar(thefile); with nam do begin length:=0; repeat length:=succ(length); read(thefile,c); letters[length] := c until (eoln(thefile)) or (length>=namelength) or (letters[length]=' '); if letters[length]=' ' then length:=length-1; if length 'n' then begin skipstar(thefile); if not eoln(thefile) then begin if thefile^ = '#' then begin numbered := true; get(thefile); (* move past the number symbol *) read(thefile,number); end end; repeat readln(thefile); theline := succ(theline) until thefile^ = 'n'; readln(thefile); theline := succ(theline) end else begin readln(thefile); theline := succ(theline) end end end; (* brnotenumber *) (* end module book.brnotenumber version = 7.64; {of delmod.p 2004 Jul 18} *) (* begin module book.brnote *) procedure brnote(var thefile: text; var theline: integer; var note: lineptr); (* read note key *) var newnote: lineptr; (* the new note *) previousnote: lineptr; (* the last line of the notes *) begin (* brnote *) note:=nil; if thefile^ = 'n' then begin (* enter note *) readln(thefile); theline := succ(theline); if thefile^ <> 'n' then begin (* abort null note (n/n) *) getline(note); newnote:=note; while thefile^ <> 'n' do begin (* wait until end of note *) brline(thefile,theline,newnote); previousnote:=newnote; (* get next note *) getline(newnote^.next); newnote:=newnote^.next; end; (* last note was not used, so: *) clearline(newnote); previousnote^.next:=nil; readln(thefile); theline := succ(theline); end else begin readln(thefile); theline := succ(theline); end; end end; (* brnote *) (* end module book.brnote version = 7.64; {of delmod.p 2004 Jul 18} *) (* begin module book.brheader *) procedure brheader(var thefile: text; var theline: integer; var hea: header); (* read the header of a key. *) begin with hea do begin readln(thefile); (* move past the object name - new definition 1999 Mar 13 *) theline := succ(theline); {bbb} (* read key name *) brname(thefile,theline,keynam); (* read full name *) getline(fulnam); brline(thefile,theline,fulnam); (* read note key *) if readnumber then brnotenumber(thefile,theline,note) else brnote(thefile,theline,note) end end; (* end module book.brheader version = 7.64; {of delmod.p 2004 Jul 18} *) (* begin module book.copyheader *) procedure copyheader(fromhea: header; var tohea: header); (* copy the header fromhea into tohea. Note that the linked objects are NOT copied, but merely pointed to. *) begin tohea.keynam.letters := fromhea.keynam.letters; tohea.keynam.length := fromhea.keynam.length; tohea.note := fromhea.note; tohea.fulnam := fromhea.fulnam; end; (* end module book.copyheader version = 7.64; {of delmod.p 2004 Jul 18} *) (* begin module book.brpiekey *) procedure brpiekey(var thefile: text; var theline: integer; var pie: piekey); (* read piece key, track the line number *) begin with pie do begin brheader(thefile,theline,hea); brreanum(thefile,theline,mapbeg); brconfig(thefile,theline,coocon); brdirect(thefile,theline,coodir); brnumber(thefile,theline,coobeg); brnumber(thefile,theline,cooend); brconfig(thefile,theline,piecon); brdirect(thefile,theline,piedir); brnumber(thefile,theline,piebeg); brnumber(thefile,theline,pieend); end end; (* end module book.brpiekey version = 7.64; {of delmod.p 2004 Jul 18} *) (* begin module book.brdna *) procedure brdna(var thefile: text; var theline: integer; var dna: dnaptr); (* read in dna from thefile, track the line *) (* note: if the dna were circularized, by linking the last dnastring to the first, then the cleardna routine could not clear properly, and would loop forever... there is no reason to do that, since a simple mod function will allow one to access the circle. *) var ch: char; workdna: dnaptr; begin getdna(dna); workdna:=dna; ch:=getto(thefile,theline,['d']); readln(thefile); theline := succ(theline); read(thefile,ch); (* skipstar *) while (ch = '*') do begin read(thefile,ch); (* skip blank *) repeat read(thefile,ch); if ch in ['a','c','g','t'] then begin if workdna^.length=dnamax then begin getdna(workdna^.next); workdna:=workdna^.next end; workdna^.length:=succ(workdna^.length); workdna^.part[workdna^.length]:=chartobase(ch) end until eoln(thefile); readln(thefile); (* go to next line *) theline := succ(theline); read(thefile,ch); (* ch is either '*' or 'd' *) end; readln(thefile); (* read past the d *) theline := succ(theline); end; (* end module book.brdna version = 7.64; {of delmod.p 2004 Jul 18} *) (* begin module book.brpiece *) procedure brpiece(var thefile: text; var theline: integer; var pie: pieceptr); (* read in a piece, change theline to reflect the lines traversed *) begin { readln(thefile); (* move past the word 'piece' - new definition 1999 Mar 13 *) theline := succ(theline); (* BUG: was below! *) bbb} brpiekey(thefile,theline,pie^.key); if numbered or (not skipunnum) then brdna(thefile,theline,pie^.dna); readln(thefile); (* move past the word 'piece' - new definition 1999 Mar 13 *) theline := succ(theline); end; (* end module book.brpiece version = 7.64; {of delmod.p 2004 Jul 18} *) (* begin module book.brinit *) procedure brinit(var book: text; var theline: integer); (* check that the book is ok to read, and set up the global variables for br routines *) begin (* brinit *) (* halt if the book is bad (first word is 'halt') or the first character is not * *) reset(book); if not eof(book) then begin (* check for the date line *) if book^ <> '*' then begin if book^ <> 'h' then writeln(output, ' this is not the first line of a book:') else writeln(output, ' bad book:'); write(output, ' '); while not (eoln(book) or eof(book)) do begin write(output, book^); get(book) end; writeln(output); halt end end else begin writeln(output, ' book is empty'); halt end; (* initialize free storage *) freeline:=nil; freedna:=nil; readnumber:=true; (* usually we read in numbers for items *) number:=0; (* arbitrary value *) numbered:=false; (* the piece has no number (none yet read in) *) skipunnum:=false; theline := 1; end; (* brinit *) (* end module book.brinit version = 7.64; {of delmod.p 2004 Jul 18} *) (* ************************************************************************ *) (* end module package.brpiece version = 7.64; {of delmod.p 2004 Jul 18} *) (* begin module book.brorgkey *) procedure brorgkey(var thefile: text; var theline: integer; var org: orgkey); (* read organism key *) begin with org do begin {bbb} brheader(thefile,theline,hea); getline(mapunit); brline(thefile,theline,mapunit); end end; (* end module book.brorgkey version = 7.64; {of delmod.p 2004 Jul 18} *) (* begin module book.brchrkey *) procedure brchrkey(var thefile: text; var theline: integer; var chr: chrkey); (* read chromosome key *) begin with chr do begin {bbb} brheader(thefile,theline,hea); brreanum(thefile,theline,mapbeg); brreanum(thefile,theline,mapend); end end; (* end module book.brchrkey version = 7.64; {of delmod.p 2004 Jul 18} *) (* begin module book.getocp *) procedure getocp(var thefile: text; var theline: integer; var org: orgkey; var orgchange, orgopen: boolean; var chr: chrkey; var chrchange, chropen: boolean; var pie: pieceptr; var piechange, pieopen: boolean); (* Get the next piece and its organism and chromosome keys. The three change variables indicate whether or not a new organism, chromosome or piece name was found. If a piece is not found, then pieopen will be false. orgopen, chropen and pieopen are used by getocp to tell when it has entered an organism, chromosome or piece. All booleans should be set to false initially. There should be one triplet for each book read. It is important to initialize ALL variables, including pie: orgchange := false; orgopen := false; chrchange := false; chropen := false; piechange := false; pieopen := false; pie := nil; theline := 0; 1999 June 2 The book reading routines now treat data objects more precisely. Rather than test for eof, the endo of book occurs when pieopen is returned as false. A book reading loop now looks like this: repeat getocp(book, theline, org, orgchange, orgopen, chr, chrchange, chropen, pie, piechange, pieopen); writeln(output,'pieopen: ',pieopen); if pieopen then begin writeln(output,'piece at line: ',theline:1); end; until not pieopen; *) var ch: char; newchr: chrkey; neworg: orgkey; newpie: pieceptr; begin ch:='a'; while not (ch in [' ','p']) do begin ch:=getto(thefile,theline,['o','c','p']); if ch <> ' ' then begin case ch of 'o': if orgopen then begin readln(thefile); (* move past the word 'organism' - new definition 1999 Mar 13 *) orgopen:=false (* close organism *) end else begin brorgkey(thefile,theline,neworg); if (neworg.hea.keynam.letters <> org.hea.keynam.letters) and (neworg.hea.keynam.length <> org.hea.keynam.length) then begin { writeln(output,'--------orgchanged!'); write (output,'--------old org:"', org.hea.keynam.letters); writeln(output, '" ', org.hea.keynam.length:1); write (output,'--------new org:"',neworg.hea.keynam.letters); writeln(output, '" ',neworg.hea.keynam.length:1); } (*ccc*) orgchange:=true; copyheader(neworg.hea,org.hea); (* move the mapunit over to the org! *) org.mapunit := neworg.mapunit; clearline(neworg.mapunit); end else orgchange:=false; orgopen:=true; end; 'c': if chropen then begin readln(thefile); (* move past the word 'chromosome' - new definition 1999 Mar 13 *) chropen:=false (* close chromosome *) end else begin brchrkey(thefile,theline,newchr); if (newchr.hea.keynam.letters <> chr.hea.keynam.letters) and (newchr.hea.keynam.length <> chr.hea.keynam.length) then begin { writeln(output,'--------chrchanged!'); write (output,'--------old chr:"', chr.hea.keynam.letters); writeln(output, '" ', chr.hea.keynam.length:1); write (output,'--------new chr:"',newchr.hea.keynam.letters); writeln(output, '" ',newchr.hea.keynam.length:1); } chrchange:=true; copyheader(newchr.hea,chr.hea); (* move the map range over to the chr! *) chr.mapbeg := newchr.mapbeg; chr.mapend := newchr.mapend; end else chrchange:=false; chropen:=true; end; 'p': if pieopen then begin pieopen:=false; (* close last piece *) ch:='a' (* prevent falling out of the loop *) end else begin new(newpie); brpiece(thefile,theline,newpie); if pie = nil then piechange := true else begin if (newpie^.key.hea.keynam.letters <> pie^.key.hea.keynam.letters) and (newpie^.key.hea.keynam.length <> pie^.key.hea.keynam.length) then begin piechange:=true; end else piechange:=false; end; pieopen:=true; (* we always have to switch over to the new piece, because although the name may be the same, the DNA sequence could be different. That is, the book may contain two pieces with the same name, and we want to be sure to search the new one, not the old one. *) if pie <> nil then begin clearpiece(pie); (* save the links *) dispose(pie); (* close up shop *) end; pie := newpie; end end end else begin pieopen := false end end end; (* origin: search version = 6.39 *) (* end module book.getocp version = 7.64; {of delmod.p 2004 Jul 18} *) (* ************************************************************************ *) (* end module package.getocp version = 7.64; {of delmod.p 2004 Jul 18} *) (* begin module book.getbase *) function getbase(position: integer; pie: pieceptr):base; (* Get a base from the position (internal coordinates) of the piece. Protection is made against positions outside the piece. In the case of circles it would be convenient to wrap around when requests are off the end. So the routine will do a modular wrap for positions outside the range 1 to the length. This is a new feature as of 2000 March 22. *) var workdna: dnaptr; (* pointer to the dna part of pie *) p: integer; (* current count of bases into the workdna *) spot: integer; (* the last base of the dna part *) thelength: integer; (* the length of the piece *) begin { writeln(output,'NEW getbase: position=',position:1,'^^^^^^^^^^^^^^^^^^^^'); } (* handle cases of position out of range by circular wrapping *) thelength := piecelength(pie); while position < 1 do position := position + thelength; while position > thelength do position := position - thelength; workdna:=pie^.dna; p:=workdna^.length; while position > p do begin { writeln(output,' workdna^.length=',workdna^.length:1); } workdna := workdna^.next; if workdna = nil then begin writeln(output,'error in function getbase!'); halt end; p := p + workdna^.length; end; { writeln(output,'p=',p:1); } if workdna = nil then begin writeln(output,'error in getbase: request off end of piece'); halt end else begin spot := workdna^.length - (p-position); { writeln(output,'spot=',spot:1); showdnasegment(output,workdna, spot); } if (spot <= 0) then begin writeln(output,'error in getbase, spot (= ',spot:1, ') must be positive'); halt end; if (spot > workdna^.length) then begin writeln(output,'error in getbase, spot (=',spot:1, ') must be less than length (=',workdna^.length:1,')'); halt end; { writeln(output,'base = ', workdna^.part[spot]); } getbase:=workdna^.part[spot] end end; (* end module book.getbase version = 7.64; {of delmod.p 2004 Jul 18} *) (* begin module book.stepbase *) function stepbase(startdna: dnaptr; var dna: dnaptr; var d: dnarange): base; (* advance d by one base in dna and then return the base at the new d. (this means that one should initialize d to zero) if we go past the last base, we restart at startdna. note: d is not the number of the base... it is used as a record for stepbase. do not mess with it, and do not use it to find out what base you are on. use a separate counter. *) begin if (d=dnamax) or (d=dna^.length) then begin d:=1; dna:=dna^.next; if dna=nil then dna:=startdna end else d:=succ(d); stepbase:=dna^.part[d] end; (* end module book.stepbase version = 7.64; {of delmod.p 2004 Jul 18} *) (* begin module book.iwname *) procedure iwname(var thefile: text; thename: name); (* write the name to the file *) var c: integer; begin for c:=1 to thename.length do write(thefile, thename.letters[c]) end; (* end module book.iwname version = 7.64; {of delmod.p 2004 Jul 18} *) (* begin module book.iworg *) procedure iworg(var afile: text; org: orgkey); (* write an organism specification. no writeln is done to allow write orgchr to do this. *) begin write(afile,'organism '); iwname(afile,org.hea.keynam); write(afile,';'); end; (* end module book.iworg version = 7.64; {of delmod.p 2004 Jul 18} *) (* begin module book.iwchr *) procedure iwchr(var afile: text; chr: chrkey); (* write an chromosome specification. no writeln is done to allow write orgchr to do this. *) begin write(afile,'chromosome '); iwname(afile,chr.hea.keynam); write(afile,';'); end; (* end module book.iwchr version = 7.64; {of delmod.p 2004 Jul 18} *) (* begin module book.iwpie *) procedure iwpie(var afile: text; pie: piekey); (* write a piece specification *) begin write(afile,'piece '); iwname(afile,pie.hea.keynam); writeln(afile,';'); end; (* end module book.iwpie version = 7.64; {of delmod.p 2004 Jul 18} *) (* begin module book.iworgchr *) procedure iworgchr(var afile: text; org: orgkey; orgchange, orgopen: boolean; chr: chrkey; chrchange, chropen: boolean); (* write both organism and chromosome specifications, based on whether the organism or chromosome changed (orgchange and chrchange) and whether they are currently open (orgopen, chropen). See getocp in the br routines. *) begin if orgchange and orgopen then iworg(afile,org); if orgchange and chrchange and orgopen and chropen then write(afile,' '); if chrchange and chropen then iwchr(afile,chr); if (orgchange and orgopen) or (chrchange and chropen) then writeln(afile) end; (* end module book.iworgchr version = 7.64; {of delmod.p 2004 Jul 18} *) (* begin module book.iwget *) procedure iwget(var afile: text; pie: pieceptr; fromplace, pieceplace, toplace: integer; flip: boolean; insttype: integer; carriagereturn: boolean); (* print a get delila instruction in the orientation of pie, from fromplace to toplace pieceplace. +/- direction; If flip is false, the piece direction is as on the piece, if it is true, the it is the opposite direction. insttype: instruction type. insttype=1 means the form get from p -/+f to same +/-t dir +/-; insttype=2 means the form get from p1 -/+f to p2 +/-t dir +/-; where p, p1 and p2 are locations carriagereturn: if true, add a carriage return to the end of the line. *) procedure iwposition(relative: integer; sameallowed: boolean); (* write the *) procedure iwrelative(relative: integer); begin if relative>=0 then write(afile,' +', relative:1) else if relative< 0 then write(afile,' ',relative:1) end; begin (* iwposition *) if (insttype = 1) and sameallowed then write(afile,' same') else write(afile,' ',pieceplace:1); case pie^.key.piedir of plus: iwrelative(+relative); minus: iwrelative(-relative); end end; begin (* iwget *) write(afile,'get from'); iwposition(fromplace, false); write(afile,' to'); iwposition(toplace, true); write(afile,' direction'); case pie^.key.piedir of dirhomologous, (* handle case, may not be right *) plus: case flip of false: write(afile,' +'); true: write(afile,' -'); end; dircomplement, (* handle case, may not be right *) minus: case flip of false: write(afile,' -'); true: write(afile,' +'); end end; write(afile,';'); if carriagereturn then writeln(afile); end; (* end module book.iwget version = 7.64; {of delmod.p 2004 Jul 18} *) (* begin module book.iwget2 *) procedure iwget2(var afile: text; pie: pieceptr; fromplace, place1, toplace, place2: integer; flip: boolean; carriagereturn: boolean); (* print a get Delila instruction in the orientation of pie, The form of the instructions is: get from place1 +/-fromplace to place2 +/-toplace direction +/-; If flip is false, the piece direction is as on the piece, if it is true, the it is the opposite direction. carriagereturn: if true, add a carriage return to the end of the line. *) procedure iwposition(place, relative: integer); procedure iwrelative(relative: integer); begin if relative>=0 then write(afile,' +', relative:1) else if relative< 0 then write(afile,' ',relative:1) end; begin (* iwposition *) write(afile,' ',place:1); case pie^.key.piedir of plus: iwrelative(+relative); minus: iwrelative(-relative); end end; begin (* iwget2 *) write(afile,'get from'); iwposition(place1,fromplace); write(afile,' to'); iwposition(place2,toplace); write(afile,' direction'); case pie^.key.piedir of dirhomologous, (* handle case, may not be right *) plus: case flip of false: write(afile,' +'); true: write(afile,' -'); end; dircomplement, (* handle case, may not be right *) minus: case flip of false: write(afile,' -'); true: write(afile,' +'); end end; write(afile,';'); if carriagereturn then writeln(afile); end; (* end module book.iwget2 version = 7.64; {of delmod.p 2004 Jul 18} *) (* begin module book.iwcombk *) procedure iwcombk(var book, afile: text); (* make a comment in the file that says the name of the book *) begin write(afile,'(* '); reset(book); if copylines(book, afile, 1) = 0 then begin writeln(output, ' book is empty, can not write comment for instructions'); halt end; writeln(afile,'*)'); end; (* end module book.iwcombk version = 7.64; {of delmod.p 2004 Jul 18} *) (* begin module package.datetime *) (* ************************************************************************ *) (* begin module getdatetime *) procedure getdatetime(var adatetime: datetimearray); (* get the date and time into a single array from the system clock. adatetime contains the date: 1980/06/09 18:49:11 ye mo da ho mi se (year, month, day, hour, minute, second). As of 2000 February 18, the Sun Pascal compiler requires a formatting statement. This statement allows the date to be generated in this standard Delila format in a single call. Information about the formatting statement is available on the manual page for date in Unix. If a computer does not have this method, see the 'oldgetdatetime' routine in delmod.p (http://www.lecb.ncifcrf.gov/~toms/delila/delmod.html) for some conversion code. GPC Functions: function GetUnixTime (var MicroSecond : Integer) : UnixTimeType; http://agnes.dida.physik.uni-essen.de/~gnu-pascal/gpc_109.html#SEC109 7.10.8 Date And Time Routines procedure GetTimeStamp (var t : TimeStamp); function Date (t : TimeStamp) : packed array [1 .. DateLength] of Char; function Time (t : TimeStamp) : packed array [1 .. TimeLength] of Char; DateLength and TimeLength are implementation dependent constants. GetTimeStamp (t) fills the record `t' with values. If they are valid, the Boolean flags are set to True. TimeStamp is a predefined type in the Extended Pascal standard. It may be extended in an implementation, and is indeed extended in GPC. For the full definition of `TimeStamp', see section 8.255 TimeStamp. *) var t: TimeStamp; (* begin module pluckdigit *) function pluckdigit(number, logplace:integer): char; (* return the digit at the place value ('logplace') position of number. example: pluckdigit(13625, 3) = 3 pluckdigit(13625, 4) = 1 This routine was taken from module numberdigit in prgmod.p, but is modified so as not to give the sign. Instead it gives zeros above the digits. 'myabsolute' replaced 'absolute', which is apparently a keyword for GPC. The name is kept for to keep the code looking similar to its origin. *) var place: integer; (* the exponent of logplace *) count: integer; (* used to make place *) myabsolute: integer; (* the absolute value of number *) acharacter: char; (* the character to be returned *) procedure digit; (* extract a digit at the place position *) var tenplace: integer; (* ten times place *) z: integer; (* an intermediate value *) d: integer; (* the digit extracted *) begin (* digit *) tenplace:=10*place; z:=myabsolute-((myabsolute div tenplace)*tenplace); if place = 1 then d:=z else d:= z div place; case d of 0: acharacter:='0'; 1: acharacter:='1'; 2: acharacter:='2'; 3: acharacter:='3'; 4: acharacter:='4'; 5: acharacter:='5'; 6: acharacter:='6'; 7: acharacter:='7'; 8: acharacter:='8'; 9: acharacter:='9'; end end; (* digit *) begin (* pluckdigit *) place:=1; for count:=1 to logplace do place:=10*place; if number=0 then begin acharacter:='0' end else begin myabsolute:=number; if myabsolute >= place then digit else acharacter := '0' end; pluckdigit:=acharacter end; (* pluckdigit *) (* end module pluckdigit *) begin (* according to: http://agnes.dida.physik.uni-essen.de/~gnu-pascal/gpc_109.html#SEC109 *) GetTimeStamp(t); (* Predefined time stamp: http://agnes.dida.physik.uni-essen.de/~gnu-pascal/gpc_389.html#SEC389 TimeStamp = {@@packed} record DateValid, TimeValid : Boolean; Year : Integer; Month : 1 .. 12; Day : 1 .. 31; DayOfWeek : 0 .. 6; { 0 means Sunday } Hour : 0 .. 23; Minute : 0 .. 59; Second : 0 .. 61; { to allow for leap seconds } MicroSecond : 0 .. 999999 end; *) with t do begin if TimeValid then begin { writeln(output,'valid time'); writeln(output,'year =',year:4); writeln(output,'month =',month:2); writeln(output,'day =',day:2); writeln(output,'hour =',hour:2); writeln(output,'minute =',minute:2); writeln(output,'second =',second:2); } adatetime := 'year/mm/dd hh:mm:ss'; adatetime[ 1] := pluckdigit(Year,3); adatetime[ 2] := pluckdigit(Year,2); adatetime[ 3] := pluckdigit(Year,1); adatetime[ 4] := pluckdigit(Year,0); adatetime[ 6] := pluckdigit(Month,1); adatetime[ 7] := pluckdigit(Month,0); adatetime[ 9] := pluckdigit(Day,1); adatetime[10] := pluckdigit(Day,0); adatetime[12] := pluckdigit(Hour,1); adatetime[13] := pluckdigit(Hour,0); adatetime[15] := pluckdigit(Minute,1); adatetime[16] := pluckdigit(Minute,0); adatetime[18] := pluckdigit(Second,1); adatetime[19] := pluckdigit(Second,0); end else begin writeln(output,'getdatetime: invalid time!'); halt; end end; { Sun compiler method: date(adatetime,'%Y/%m/%d %H:%M:%S'); } end; (* end module getdatetime version = 1.17; (@ of timegpc.p 2002 Oct 9 *) (* begin module readdatetime *) procedure readdatetime (var thefile: text; var adatetime: datetimearray); (* read the date and time from the file. It must have this format: 123456789 123456789 1 1980/06/09 18:49:11 *) (* 2001 Jan 2: thefile is not written to! Force 4 digit years. 2000 Oct 11: upgraded so that the p2c compiler does not object to writing out the adatetime; added checks for the date. *) var index: integer; (* to the udatetime *) (* the following is an unpacked date time array, to avoid reading into a packed array. reading into a packed array is not transportable *) udatetime: array[1..datetimearraylength] of char; begin for index:=1 to datetimearraylength do read(thefile,udatetime[index]); pack(udatetime, 1, adatetime); if (adatetime[3]='/') and (adatetime[12]=':') then begin writeln(output,'You have an old datetime (only 2 year digits): '); for index:=1 to datetimearraylength do write(output,adatetime[index]); writeln(output); writeln(output,'Convert your database to 4 digit years.'); halt; end; (* check the adatetime format. Note that further checks for the other positions in the array could be done to be sure that they are numbers. But this should be pretty good. *) if (adatetime[ 5]<>'/') or (adatetime[ 8]<>'/') or (adatetime[14]<>':') or (adatetime[17]<>':') then begin writeln(output,'readdatetime: bad date time read:'); for index:=1 to datetimearraylength do write(output,adatetime[index]); writeln(output); halt end; end; (* end module readdatetime version = 1.17; (@ of timegpc.p 2002 Oct 9 *) (* begin module writedatetime *) procedure writedatetime(var thefile: text; adatetime: datetimearray); (* expand the date and time out and print in the file *) var index: integer; (* index of datetime *) begin for index:=1 to datetimearraylength do write(thefile,adatetime[index]) end; (* end module writedatetime version = 1.17; (@ of timegpc.p 2002 Oct 9 *) (* begin module timeseed *) (* Read the computer date and time. Reverse the order of the digits and put a decimal point in front. This gives a fraction between zero and one that varies quite quickly, and is always unique (if the computer has sufficient accuracy). It is to be used as a seed to a random number generator. This has the nice property that the seed changes every second and does not repeat for thousands of years! *) procedure addtoseed(var seed, power: real; c: char); (* add the digit represented by c to the seed at the power position *) var n: integer; (* the character represented by c *) begin (* addtoseed *) power := power/10; { writeln(output,'addtoseed, c = ',c); writeln(output,'addtoseed, ord(c) = ',ord(c)); } n := ord(c) - ord('0'); if (n < 0) or (n > 9) then begin writeln(output,'timeseed: error in datetime'); writeln(output,'it contains "',c,'" which is not a number.'); writeln(output,'The getdatetime routine must be fixed.'); halt; end; seed := seed + power*n end; (* addtoseed *) procedure makeseed(adatetime: datetimearray; var seed: real); (* convert adatetime to a real number in seed, reversed order Here is the standard adatetime format: 123456789 123456789 1 1980/06/09 18:49:11 *) var power: real; (* a digit of the seed such as 0.01 *) begin seed := 0.0; power := 1.0; addtoseed(seed, power, adatetime[19]); addtoseed(seed, power, adatetime[18]); (* : *) addtoseed(seed, power, adatetime[16]); addtoseed(seed, power, adatetime[15]); (* : *) addtoseed(seed, power, adatetime[13]); addtoseed(seed, power, adatetime[12]); (* *) addtoseed(seed, power, adatetime[10]); addtoseed(seed, power, adatetime[ 9]); (* / *) addtoseed(seed, power, adatetime[ 7]); addtoseed(seed, power, adatetime[ 6]); (* / *) addtoseed(seed, power, adatetime[ 4]); addtoseed(seed, power, adatetime[ 3]); addtoseed(seed, power, adatetime[ 2]); addtoseed(seed, power, adatetime[ 1]); end; procedure orderseed(adatetime: datetimearray; var seed: real); (* convert adatetime to a real number in seed, normal order *) var power: real; (* a digit of the seed such as 0.01 *) begin seed := 0.0; power := 1.0; addtoseed(seed, power, adatetime[ 3]); addtoseed(seed, power, adatetime[ 4]); addtoseed(seed, power, adatetime[ 6]); addtoseed(seed, power, adatetime[ 7]); (* / *) addtoseed(seed, power, adatetime[ 9]); addtoseed(seed, power, adatetime[10]); (* / *) addtoseed(seed, power, adatetime[12]); addtoseed(seed, power, adatetime[13]); (* *) addtoseed(seed, power, adatetime[15]); addtoseed(seed, power, adatetime[16]); (* : *) addtoseed(seed, power, adatetime[18]); addtoseed(seed, power, adatetime[19]); end; procedure timeseed(var seed: real); (* read the computer date and time. reverse the order of the digits and put a decimal point in front. this gives a fraction between zero and one that varies quite quickly, and is always unique (if the computer has sufficient accuracy). it is to be used as a seed to a random number generator. *) var adatetime: datetimearray; (* a date and time *) begin (* timeseed *) getdatetime(adatetime); { writeln(output,'timeseed: adatetime: ',adatetime); } makeseed(adatetime, seed); end; (* timeseed *) (* end module timeseed version = 1.17; (@ of timegpc.p 2002 Oct 9 *) (*[[*) (* begin module limitdate *) procedure limitdate(a,b,c,d: char; limitdatetime: datetimearray); (* test whether the current time is before the limit. If it is later, halt the program *) var adatetime: datetimearray; (* a date and time *) Dday: real; (* the critical day *) now: real; (* this very moment *) begin getdatetime(adatetime); { writeln(output,'adatetime:',adatetime); writeln(output,'adatetime[1]: ', adatetime[1]); writeln(output,'adatetime[2]: ', adatetime[2]); writeln(output,'adatetime[3]: ', adatetime[3]); writeln(output,'adatetime[4]: ', adatetime[4]); writeln(output,'adatetime[5]: ', adatetime[5]); } orderseed(adatetime, now); if (limitdatetime[1] <> ' ') or (limitdatetime[2] <> ' ') or (limitdatetime[3] <> ' ') or (limitdatetime[4] <> ' ') then halt; limitdatetime[1] := a; limitdatetime[2] := b; limitdatetime[3] := c; limitdatetime[4] := d; orderseed(limitdatetime, Dday); { writeln(output,'now: ',now:20:10); writeln(output,'Dday: ',Dday:20:10); } if now > Dday then begin writeln(output,'This program expired on ',limitdatetime); writeln(output,'See: http://www.lecb.ncifcrf.gov/~toms/walker/contacts.html'); halt end end; (* end module limitdate version = 1.17; (@ of timegpc.p 2002 Oct 9 *) (*]]*) (* ************************************************************************ *) (* end module package.datetime version = 10.57; (@ of lister.p 2004 Jul 22 *) (* begin module package.interact *) (* ************************************************************************ *) (* begin module interact.prompt *) procedure prompt(var afile: text); (* prompt a file. the prompt is sent to the output file, and a line is read into the pascal line buffer. (for the cyber system this means to readln afile.) guarantee no bomb *) begin (* prompt *) if eof(afile) then reset(afile); readln(afile); end; (* prompt *) (* end module interact.prompt version = 4.73; (@ of prgmod.p 2004 Jul 22 *) (* begin module interact.readchar *) procedure readchar(var afile:text; var ch: char); (* read a character from afile, guarantee no bomb *) begin (* readchar *) if eof(afile) then prompt(afile); read(afile,ch); (*writeln(output,'"',ch,'"') *) end; (* readchar *) (* end module interact.readchar version = 4.73; (@ of prgmod.p 2004 Jul 22 *) (* begin module clearstring *) procedure clearstring(var ribbon: string); (* empty the string *) var index: integer; (* to the ribbon *) begin (* clearstring *) with ribbon do begin for index := 1 to maxstring do letters[index] := ' '; length := 0; current := 0; end end; (* clearstring *) procedure initializestring(var ribbon: string); (* start the string with a nil pointer. This routine should be called before doing linked list work. This allows the standard string routines to clear the string without killing the pointer. *) begin (* initializestring *) clearstring(ribbon); ribbon.next := nil; end; (* initializestring *) (* end module clearstring version = 4.73; (@ of prgmod.p 2004 Jul 22 *) (* begin module interact.readstring *) procedure readstring(var afile: text; var line: string); (* read in a string from afile, protect against bombing *) var index: integer; (* for line *) cha: char; (* a character read in *) done: boolean; (* used for removing trailing blanks from the line *) acceptable: boolean; (* was the line typed short enough? *) begin (* readstring *) with line do begin repeat clearstring(line); prompt(afile); index := 0; (* we now count characters *) while (not eoln(afile)) and (index < maxstring) do begin index:=succ(index); readchar(afile,cha); line.letters[index]:=cha end; if not eoln(afile) then begin writeln(output, 'type lines shorter than ', (maxstring+1): 1, ' characters. please retype the line...'); acceptable := false end else acceptable := true until acceptable; length := index; if length > 0 then begin done := false; repeat (* remove blanks from the line. note that a while loop can not be used because one must avoid letters[0], since that position does not exist... *) if letters[length] = ' ' then length := pred(length) else done := true; if length = 0 then done := true until done end; if length > 0 then current := 1 else current := 0 end end; (* readstring *) (* end module interact.readstring version = 4.73; (@ of prgmod.p 2004 Jul 22 *) (* begin module interact.figurestring *) procedure figurestring( var line: string; (* a string of characters to figure out *) var first: integer; (* first found non-blank character in the line *) var last: integer; (* last character before a blank after first *) var whzat: char; (* what the token is *) var c: char; (* the first character of the token *) var i: integer; (* integer value of token if it is integer; or 0 *) var r: real); (* the real value if it is real; or 0.0 *) (* figurestring figures out the tokens in a string. it recognizes words, integers, reals and poorly formed numbers. you can easily use it to parse lines. our goal is to figure out what thing is on a string. start looking at the current place on the line. first and last are the first 'token' in line after start. the current place is updated to the letter after last. the thing found is described by the value of whzat: 'c': character (when the token does not begin with a digit, '+', or '-') 'i': integer 'r': real ' ': blank line 'g': garbage, cannot figure it out and the value of the thing found is the appropriate variable *) var numbers: set of '0'..'9'; sign: integer; (* sign of a number *) numberstart: integer; (* the point a number starts, beyond its sign, if any *) point: integer; (* location of decimal point *) power: integer; (* of 10 representing a place value in the number *) l: integer; (* an index for dissecting numbers *) function figureinteger(first,last:integer):integer; (* figure the integer in the token *) var i: integer; (* index *) sum, increment: integer; begin (* figureinteger *) power:=1; (* start at ones place *) sum:=0; (* start sum at zero *) for i:=last downto first do begin case line.letters[i] of '0': increment:=0; '1': increment:=1; '2': increment:=2; '3': increment:=3; '4': increment:=4; '5': increment:=5; '6': increment:=6; '7': increment:=7; '8': increment:=8; '9': increment:=9 end; sum:=sum+power*increment; power:=power*10 end; figureinteger:=sum end; (* figureinteger *) begin (* figurestring *) numbers:=['0','1','2','3','4','5','6','7','8','9']; (* c:=' '; i:=0; r:=0.0; do not affect these variables unless necessary *) point:=0; whzat := '.'; (* assume that we have someting to work on *) (* now to see if that is true: *) with line do if (length = 0) or (current < 1) or (current > length) then whzat := ' ' else begin (* figure out where the first token is in the line *) first:=line.current; while (line.letters[first]=' ') and (first < line.length) do first:=succ(first); if (first = line.length) and (line.letters[first] = ' ') then whzat := ' '; end; if whzat <> ' ' then begin last:=first; while (line.letters[last]<>' ') and (last < line.length) do last:=succ(last); if line.letters[last] = ' ' then last := pred(last); (* the token is between inclusive first and last *) c:=line.letters[first]; if (c in numbers) or (c in ['+','-']) then begin if c in ['+','-'] then begin case c of '+': sign:=+1; '-': sign:=-1; end; numberstart:=succ(first) end else begin sign:=+1; numberstart:=first end; whzat:='i'; for l:=numberstart to last do begin if not(line.letters[l] in numbers) then if line.letters[l]='.' (* we found a period *) then if whzat='i' (* if so far it is numbers *) then begin whzat:='r'; (* it is actually real *) point:=l end else whzat:='g' (* it is a second '.', ie garbage *) else whzat:='g' (* it is garbage *) end; (* if it is only numbers, it is integer *) (* build number *) (* if it ends in a period, it is integer *) if (whzat = 'r') and (point = last) then whzat:='i'; if whzat = 'i' then begin if point = last (* had an ending decimal point *) then i:=sign * figureinteger(numberstart,pred(last)) else i:=sign * figureinteger(numberstart,last); r:=i end else if whzat = 'r' then begin i:=figureinteger(numberstart,point-1); r:=sign * (i+figureinteger(point+1,last)/power); i:=sign * i end end else begin whzat:='c'; end; (* move the start to just beyond the last character of the token *) line.current:=succ(last) end end; (* figurestring *) (* end module interact.figurestring version = 4.73; (@ of prgmod.p 2004 Jul 22 *) (* ************************************************************************ *) (* end module package.interact version = 4.73; (@ of prgmod.p 2004 Jul 22 *) (* begin module copystring *) procedure copystring(a: string; var b: string); (* copy string a to b *) var l: integer; (* index to the string *) begin b.length := a.length; for l := 1 to a.length do b.letters[l] := a.letters[l] end; (* end module copystring version = 4.73; (@ of prgmod.p 2004 Jul 22 *) (* begin module nametostring *) procedure nametostring(a: name; var b: string); (* copy delila type name a to string b *) var l: integer; (* index to the strings *) begin b.length := a.length; for l := 1 to a.length do b.letters[l] := a.letters[l] end; (* end module nametostring *) (* begin module package.interact.gets *) (* ************************************************************************ *) (* begin module interact.nostring *) function nostring(var buffer: string): boolean; (* true if there are no characters in the rest of the buffer; false if there are characters. also, if there is no buffer, then buffer.length is set to 0 *) var answer: boolean; (* the answer returned *) procedure kill; (* destroy the line *) begin (* kill *) answer := true; (* blood and gore *) clearstring(buffer) (* total death *) end; (* kill *) begin (* nostring *) with buffer do begin if length > 0 then begin if length < maxstring then while (letters[current] = ' ') and (current < length) do current := succ(current); if current <= maxstring then if letters[current] = ' ' then kill else answer := false else kill end else kill end; nostring := answer end; (* nostring *) (* end module interact.nostring version = 4.73; (@ of prgmod.p 2004 Jul 22 *) (* begin module writestring *) procedure writestring(var tofile: text; var s: string); (* write the string s to file tofile, no writeln *) var i: integer; (* index to s *) begin (* writestring *) with s do for i := 1 to length do write(tofile, letters[i]) end; (* writestring *) (* end module writestring version = 4.73; (@ of prgmod.p 2004 Jul 22 *) (* begin module interact.flagstring *) procedure flagstring(var afile: text; var buffer: string); (* flag an error in the buffer at the current place, and clear the buffer *) begin (* flagstring *) with buffer do length := current; (* chop off the rest of the buffer *) writestring(afile, buffer); (* show the buffer *) write(afile,'? '); clearstring(buffer) end; (* flagstring *) (* end module interact.flagstring version = 4.73; (@ of prgmod.p 2004 Jul 22 *) (* begin module interact.getchar *) procedure getchar(var afile: text; var buffer: string; var cha: char; var gotten: boolean); (* get a character from the buffer, or refill the buffer and let the calling program figure out whether the buffer has non blank characters in it. *) var (* variables for calling figurestring: *) first: integer; last: integer; what: char; int: integer; rea: real; begin (* getchar *) if buffer.length = 0 then begin gotten:=false; readstring(afile,buffer) end else begin figurestring(buffer,first,last,what,cha,int,rea); gotten := (what <> ' ') end end; (* getchar *) (* end module interact.getchar version = 4.73; (@ of prgmod.p 2004 Jul 22 *) (* begin module interact.getinteger *) procedure getinteger(var afile: text; var buffer: string; var int: integer; var gotten: boolean); (* get the integer int from the buffer or interactive file afile *) var (* variables for calling figurestring: *) first: integer; last: integer; what: char; cha: char; rea: real; begin (* getinteger *) if buffer.length = 0 then begin gotten:=false; readstring(afile,buffer) end else begin figurestring(buffer,first,last,what,cha,int,rea); if what <> 'i' then begin flagstring(output,buffer); writeln(output,' please type an integer'); gotten:=false end else gotten:=true end end; (* getinteger *) (* end module interact.getinteger version = 4.73; (@ of prgmod.p 2004 Jul 22 *) (* begin module interact.getreal *) procedure getreal(var afile: text; var buffer: string; var rea: real; var gotten: boolean); (* get the real rea from the buffer or interactive file afile integer values are also accepted. *) var (* variables for calling figurestring: *) first: integer; last: integer; what: char; cha: char; int: integer; begin (* getreal *) if buffer.length = 0 then begin gotten:=false; readstring(afile,buffer) end else begin figurestring(buffer,first,last,what,cha,int,rea); if not (what in ['r', 'i']) then begin flagstring(output,buffer); writeln(output,' please type a real number'); gotten:=false end else gotten:=true end; (* handle integers *) if what = 'i' then rea := int end; (* getreal *) (* end module interact.getreal version = 4.73; (@ of prgmod.p 2004 Jul 22 *) (* begin module interact.token *) procedure token(var buffer, atoken: string; var gotten: boolean); (* get a token from the buffer *) var (* variables for calling figurestring: *) first: integer; last: integer; what: char; cha: char; int: integer; rea: real; index: integer; (* to the buffer *) begin figurestring(buffer,first,last,what,cha,int,rea); if what = ' ' then gotten := false else begin clearstring(atoken); for index := first to last do atoken.letters[index-first+1] := buffer.letters[index]; atoken.length := last - first + 1; atoken.current := 1; gotten:=true end end; (* end module interact.token version = 4.73; (@ of prgmod.p 2004 Jul 22 *) (* begin module interact.gettoken *) procedure gettoken(var afile: text; var buffer: string; var atoken: string; var gotten: boolean); (* get a token from the buffer or interactive file afile *) begin (* gettoken *) if buffer.length = 0 then begin gotten:=false; readstring(afile,buffer) end else token(buffer,atoken,gotten) end; (* gettoken *) (* end module interact.gettoken version = 4.73; (@ of prgmod.p 2004 Jul 22 *) (* ************************************************************************ *) (* end module package.interact.gets version = 4.73; (@ of prgmod.p 2004 Jul 22 *) (************************************************************************) (************************************************************************) (************************************************************************) (* begin module writename *) procedure writename(var afile: text; s: name); (* write the string s to afile *) var i: integer; (* index to the string s *) begin with s do for i := 1 to length do write(afile,letters[i]); end; (* end module writename version = 8.47; (@ of lister.p 1997 May 7 *) { (* begin module clearquotestring *) procedure clearquotestring(var s: quotestring); (* clear the quotestring s. If there is a program error, an exclamation mark will appear on the output. *) var i: integer; (* index to s *) begin for i := 1 to maxquotestring do s.string[i] := '!'; s.length := 0; end; (* end module clearquotestring version = 8.47; (@ of lister.p 1997 May 7 *) } (* begin module detabstring *) procedure detabstring(var s: string); (* Tabs are converted to blanks. This allows the tab to be a special "solid" kind of blank, but the string written won't vary with position on the line depending on the tabstops. *) const tabcharacter = 9; (* the ordinal of the tab character *) var c: char; (* a character write out *) i: integer; (* index to the string s *) begin with s do for i := 1 to length do begin c := letters[i]; if ord(c) = tabcharacter then c := ' '; (* tab converted to blank *) letters[i] := c end; end; (* end module detabstring version = 4.73; (@ of prgmod.p 2004 Jul 22 *) (* begin module writequotestring *) procedure writequotestring(var afile: text; s: string); (* Write the string s to afile, surrounded by double quote marks. Tabs are converted to blanks. This allows the tab to be a special "solid" kind of blank, but the string written won't vary with position on the line depending on the tabstops. *) begin detabstring(s); write(afile, '"'); writestring(afile, s); write(afile, '"'); end; (* end module writequotestring version = 4.73; (@ of prgmod.p 2004 Jul 22 *) (* begin module writeadefinition *) procedure writeadefinition(var afile: text; d: definitiontypeptr); (* write the definition d to file afile *) var i: integer; (* index to the string s *) begin with d^ do begin write(afile,'define'); write(afile,' '); writequotestring(afile,nametag); write(afile,' '); writequotestring(afile,background); write(afile,' '); writequotestring(afile,negparts); write(afile,' '); writequotestring(afile,posparts); for i := 1 to marks do write(afile,' ',locations[i]:1:1); {writeln(afile,'WHOOPPPIIIIEEE!'); yyy} writeln(afile); { (* don't do this here - it's awkward if one wants to just write the parts above. Just rember to write the matrix after the definition! *) writeln(afile); putriblmatrix(afile, matrix); } end; end; (* end module writeadefinition version = 4.73; (@ of prgmod.p 2004 Jul 22 *) (* begin module clearfeature *) procedure clearfeature(var f: featuretypeptr); (* clear out the feature f *) begin with f^ do begin initializestring(id); coordinate := 0; orientation := +1; initializestring(nametag); initializestring(othertag); definition := nil; (*[[*) Ri := 0.0; Z := 0.0; probability := 0.0; (*]]*) Tparam := ' '; Aparam := 0.0; Bparam := 0.0; Cparam := 0.0; Dparam := 0.0; evencoordinate := 0.0; unsatisfied := true; fromrange := 0; torange := 0; number := 0; desiredline := 0; next := nil; end end; (* end module clearfeature version = 4.73; (@ of prgmod.p 2004 Jul 22 *) (* begin module writeafeature *) procedure writeafeature(var afile: text; f: featuretypeptr); (* write the feature f to file afile in the format: @ K00000 36 +1 "nametag" "othertag" 12.200338 -0.473212 0.318031 where the last three numbers are the Ri, Z and p. Do not carriage return. *) begin with f^ do begin write(afile,'@ '); writestring(afile,id); write(afile,' ',coordinate:1:1); write(afile,' '); if orientation > 0 then write(afile,'+',orientation:1) else write(afile, orientation:1); write(afile,' '); writequotestring(afile,nametag); write(afile,' '); writequotestring(afile,othertag); (*[[*) {zzz} if definition^.matrix <> nil then begin write(afile,' ',Ri:infofield:infodecim); write(afile,' ',Z:infofield:infodecim); write(afile,' ',probability:infofield:infodecim); end else begin (* parameters, new as of 2004 July 17 *) write(afile,' ',Tparam); write(afile,' ',Aparam:infofield:infodecim); write(afile,' ',Bparam:infofield:infodecim); write(afile,' ',Cparam:infofield:infodecim); write(afile,' ',Dparam:infofield:infodecim); end (* 2004 July 17: I went ahead and removed this. As far as I know it is NOT used in feature files: if evencoordinate <> coordinate then write(afile,' ',evencoordinate:1:1); *) (*]]*) end end; (* originally from 9.29; (@ of lister.p 1999 July 5 *) (* end module writeafeature version = 4.73; (@ of prgmod.p 2004 Jul 22 *) (************************************************************************) (************************************************************************) (************************************************************************) (* end of procedure modules **********************************************) procedure addtoquotestring(var q: string; c: char); (* add the character c to the end of q *) (* 2004 Jul 18: no longer using quotestring. *) {zzz} begin with q do begin if length < maxquotestring then begin length := succ(length); letters[length] := c; end else begin writeln(output,'addtoquotestring: string cannot be extended:'); write(output,' '); {bug 2006 May 09} writequotestring(output,q); end end; end; {zzzFFF} {zzzfff} procedure numtoquotestring(var q: string; i: integer); (* add the number i to the end of q *) var { digit: integer; (* one digit of i as a number *) } digit: 0..9; (* one digit of i as a number *) newdigit: 0..127; (* ord(digit) *) c: integer; (* index to hold *) count: integer; (* how many digits were inserted *) chardigit: char; (* one digit of i as a character *) hold: string; (* for switching the digits around *) begin { writeln(searchfeatures,'numtoquotestring: i = ',i:1); clearquotestring(hold); } clearstring(hold); with hold do begin while i > 0 do begin digit := i mod 10; (* gpc: warning: type casts are a Borland Pascal extension *) { chardigit := char(digit + ord('0')); } newdigit := digit + ord('0'); (* gpc: warning: type casts are a Borland Pascal extension *) chardigit := char(newdigit); { 2001 Sep 10: it is rather puzzling why this is being objected to ... } addtoquotestring(hold,chardigit); count := succ(count); i := i div 10; { writeln(searchfeatures,'i = ',i:1); } end; end; (* We got the digits from smallest to largest, so reverse them: *) for c := hold.length downto 1 do addtoquotestring(q,hold.letters[c]); end; {zzzFFF} {zzzfff} procedure dofeatures(var searchfeatures: text; mismatches: integer; pattern: string; mispattern: string; thefeature: featuretypeptr; thedefinition: definitiontypeptr; patterncomplement: boolean); (* write out the features. If there are mismatches, define a new feature with them marked. 2008 Apr 22: rebuild the logic. The original code did not allow for additional marks besides the mutation. That is, aacta|tactgtatataaaaacagta|tcaat ~ = has '|' whch was not being placed correctly. *) const debug = false; (* turn on to test code *) var holdNPend: char; (* hold negative part end *) holdPPend: char; (* hold negative part end *) holdLOCATIONend: real; (* hold location end *) m: integer; (* index to mismatches *) stuffatend: boolean; (* there is a change at the end of the feature. In this case we do not want to overwrite the end with the original symbol. *) tmpdefinition: definitiontypeptr; (* the current definition with x changes *) tmpfeature: featuretypeptr; (* the current feature with x changes *) reversespot: integer; (* index to mismatches, the complement of m *) {yyy} done: boolean; (* done moving stuff *) mm: integer; (* the location of the place to put the base, moved across the sequence until it is in the right spot. *) thelocation: integer; (* location of a mutation to record in the feature. The first base is now defined to be zero! *) begin if mismatches = 0 then begin writeafeature(searchfeatures,thefeature); writeln(searchfeatures); { writeln(output,'WRITEAFEATURE ---------- BEGIN'); writeafeature(output,thefeature); writeln(output); writeln(output,'WRITEAFEATURE ---------- END'); } end else begin write(searchfeatures,'* ',mismatches:1,' mismatch'); if mismatches <> 1 then write(searchfeatures,'s'); writeln(searchfeatures); write(searchfeatures,'* '); writestring(searchfeatures,pattern); writeln(searchfeatures); write(searchfeatures,'* '); writestring(searchfeatures,mispattern); writeln(searchfeatures); new(tmpfeature); clearfeature(tmpfeature); new(tmpdefinition); (* copy thefeature to tmpfeature so that the changes don't affect the next result *) tmpfeature^ := thefeature^; tmpdefinition^ := thedefinition^; (* write(output,'y-thedefinition '); {yyy} writeadefinition(output,thedefinition); {yyy} *) (* Handle the ends of the feature *) { yyy neutralize old method 2008 apr 22 with tmpdefinition^ do begin (* Do the end first: remove to make space for change marks *) if mispattern.letters[mispattern.length] = 'x' then begin (* throw away end character *) stuffatend := true; end else begin (* take off the end and hold it *) stuffatend := false; holdNPend := negparts.letters[2]; holdPPend := posparts.letters[2]; holdLOCATIONend := locations[2]; end; marks := pred(marks); posparts.length := marks; negparts.length := marks; (* Now do the begin *) if mispattern.letters[1] = 'x' then begin (* remove now to never add later since there is X *) marks := pred(marks); posparts.length := marks; negparts.length := marks; end end; } with tmpfeature^ do begin definition := tmpdefinition; end; { if debug then writeln(searchfeatures,'* holdLOCATIONend ',holdLOCATIONend:1:1); if debug then writeln(searchfeatures,'* stuffatend ',stuffatend); } {QQQ} if patterncomplement then writeln(searchfeatures, '* patterncomplement!!'); for m := 1 to mispattern.length do begin if debug then writeln(output,'*yyy ',m:2,' ',pattern.letters[m],mispattern.letters[m]); if mispattern.letters[m] = 'x' then begin (* the first feature position is the zero coordinate, not 1: *) with tmpfeature^ do begin {QQQ} if patterncomplement (* first base is zero! *) then thelocation := mispattern.length - m else thelocation := m - 1; addtoquotestring( tmpfeature^.nametag,'.'); numtoquotestring( tmpfeature^.nametag,thelocation); end; with tmpdefinition^ do begin addtoquotestring(nametag,'.'); numtoquotestring(nametag,thelocation); marks := succ(marks); if marks > maxstring then begin (* 2008 apr 22 *) writeln(output, 'dofeatures: too many parts to a feature'); halt end; (* first feature position is the zero coordinate, not 1: *) negparts.length := marks; posparts.length := marks; posparts.letters[posparts.length]:='!'; {yyy} (* move the negative parts to the right to create space *) for mm := marks downto 2 do negparts.letters[mm]:= negparts.letters[mm-1]; negparts.letters[1]:='!'; (* new 2008 Apr 22: move the locations up *) (* mm is the hole location *) mm := marks-1; if debug then writeln(output,'initial mm=',mm:3); done := false; if debug then write(output,'A-tmpdefinition '); {yyy} if debug then writeadefinition(output,tmpdefinition); {yyy} (* initialize upper location: *) locations[marks] := locations[marks-1]; if debug then write(output,'a-tmpdefinition '); {yyy} if debug then writeadefinition(output,tmpdefinition); {yyy} while not done do begin if debug then write(output,'m=',m:3); if debug then write(output,' mm=',mm:3); if debug then writeln(output,' locations[mm]=',locations[mm]:3:1); if (locations[mm] <= m) or (mm < 1) then begin if debug then writeln(searchfeatures,'* mm = ', mm:1); if debug then writeln(searchfeatures,'* m = ', m :1); if debug then writeln(searchfeatures,'* marks = ', marks :1); if debug then writeln(searchfeatures,'* mispattern.length = ', mispattern.length :1); if debug then writeln(output,'(marks-mm)+1=', (marks-mm)+1:1); {yyy} if not patterncomplement then begin posparts.letters[mm+1] := pattern.letters[m]; {REVERSE!} negparts.letters[marks-mm] := chomplement(pattern.letters[m]); locations[mm+1] := thelocation; (* first base is zero! *) {QQQ} end else begin posparts.letters[mm+1] := chomplement(pattern.letters[m]); {REVERSE!} negparts.letters[marks-mm] := pattern.letters[m]; locations[mm+1] := thelocation; (* first base is zero! *) end; done := true; end else begin if debug then if mm+1>marks then writeln(output,'mm+1>marks',(mm+1):1,'>',marks:1); posparts.letters[mm+1] := posparts.letters[mm]; if debug then writeln(output,'zzz(marks-mm)+1=', (marks-mm)+1:1); {yyy} if debug then writeln(output,'zzz(marks-mm)=', (marks-mm):1); {yyy} {REVERSE!!} negparts.letters[(marks-mm)] :=negparts.letters[(marks-mm)+1]; locations[mm+1] := locations[mm]; locations[mm] := -1; (* track the open spot *) posparts.letters[mm] := '_'; {REVERSE!!} negparts.letters[(marks-mm)+1] := '_'; mm := mm - 1; end; if debug then write(output,'B-tmpdefinition '); {yyy} if debug then writeadefinition(output,tmpdefinition); {yyy} end; if debug then write(output,'C-tmpdefinition '); {yyy} if debug then writeadefinition(output,tmpdefinition); {yyy} if debug then writeln(output,'negparts.length=', negparts.length:1); {yyy} if debug then writeln(output,'posparts.length=', posparts.length:1); {yyy} {halt;} {QQQ} { original old code: if not patterncomplement then begin negparts.letters[marks] := pattern.letters[m]; end else begin reversespot := mispattern.length - m + 1; posparts.letters[marks] := pattern.letters[reversespot]; negparts.letters[marks] := pattern.letters[reversespot]; end } end end ;if debug then writeln(searchfeatures); end; {zzzfff} {zzzFFF} if debug then write(output,'x-tmpdefinition '); {yyy} if debug then writeadefinition(output,tmpdefinition); {yyy} {yyy 2008 apr 22 old code removed: (* If needed, put the end back on *) if not stuffatend then with tmpdefinition^ do begin addtoquotestring(negparts,holdNPend); addtoquotestring(posparts,holdPPend); marks := succ(marks); locations[marks] := holdLOCATIONend; end; } (* write out the new definition and feature *) {yyy} if debug then writeln(output,'tmpdefinition marks = ',tmpdefinition^.marks:1); {yyy} if debug then write(output,'y-tmpdefinition '); {yyy} if debug then writeadefinition(output,tmpdefinition); {yyy} writeadefinition(searchfeatures,tmpdefinition); writeln(searchfeatures); writeafeature(searchfeatures,tmpfeature); writeln(searchfeatures); (* clean up memory *) dispose(tmpfeature); dispose(tmpdefinition); (* halt; {yyy} *) end; end; (************************************************************************) (************************************************************************) (************************************************************************) procedure answercheck(var answers: integer); (* if the number of answers exceeds answersmax, we are probably in an infinite loop from a file input so we halt. *) begin answers := succ(answers); if answers > answersmax then begin writeln(output,'too many tries, quitting'); halt; end; end; (* answercheck *) procedure searchhelp(var f: text); (* write out all the commands to file f *) (* for extra cirricular services contact minerva baldwin *) var answer: char; begin (* searchhelp *) writeln(f,'commands:'); writeln(f,'A: set the next named feature to be an arrows like [--->'); { writeln(f,' This must be done following the " command.'); } writeln(f,'C: Define colors for the features in lister.'); writeln(f,' The form is:'); writeln(f,' C Tparam Aparam Bparam Cparam Dparam'); writeln(f,' where'); writeln(f,' Tparam is one of hHrR'); writeln(f,' h color the letters using HSB colors'); writeln(f,' r color the letters using RGB colors'); writeln(f,' H put a colored rectangle behind the letter, HSB'); writeln(f,' R put a colored rectangle behind the letter, RGB'); writeln(f,' Aparam is either Hue or Red'); writeln(f,' Bparam is either Saturation or Green'); writeln(f,' Cparam is either Brightness or Blue'); writeln(f,' Dparam is the scale to multiply the rectangle height by'); writeln(f,' Tparam determines the state used for Aparam, Bparam and Cparam'); {ppp} write (f,'D: enter Delila subsystem for writing instructions'); writeln(f,' (help is available there)'); writeln(f,'H: help (this list)'); writeln(f,'?: help (this list)'); writeln(f,'L: the single letters that correspond to the (x/y) forms'); writeln(f,'M: set maximum number of mismatches allowed (currently ', mismatches:1,')'); writeln(f,'N: a toggle switch:'); writeln(f,' If true, searches are performed when'); writeln(f,' the = command is given or when the pattern is typed.'); writeln(f,' If false, searches are performed only when the =', ' command is given.'); write (f,' (currently '); if oktosearch = true then writeln(f,'true).') else writeln(f,'false).'); writeln(f,'P: set start point (phase) and shift between search steps'); writeln(f,'q: quit'); writeln(f,'Q: quit'); writeln(f,'V: view: set viewing parameters (help is available there)'); write (f,'*: the rest of the line is a comment sent to'); writeln(f, ' the searchinst and result files'); writeln(f,'=: search for the last typed search pattern'); writeln(f,'~: complement the search pattern'); writeln(f,' This reverses the order AND complements each character.'); writeln(f,'": create searchfeatures file'); writeln(f,' * To create searchfeatures, define the name of a search string'); writeln(f,' by typing the name inside double quotes (as: "EcoRI") and then'); writeln(f,' do the search (eg type: gaattc).'); writeln(f,' * Vertical bars or carets (| or ^) in the search string (as:'); writeln(f,' g|aattc) will carry over to the feature.'); writeln(f,' * All subsequent searches will be labeled with the same name'); writeln(f,' until you give a new one.'); writeln(f,' * To turn off the features, use an empty quote string, as "".'); writeln(f,' * Because space is used to parse, no spaces are allowed in'); writeln(f,' * the names. However, the lister program will treat a tab.'); writeln(f,' * as a space, so this can be used instead.'); writeln(f,' * The searchfeatures file can be concatenated with other'); writeln(f,' features to create the features file for the lister program.'); writeln(f,' * Before using the name command, use the "A" command to '); writeln(f,' have the feature be an arrow.'); writeln(f,'I: invert: complement the characters in the search string.'); writeln(f,' This DOES NOT change the order of the characters.'); writeln(f,'R: reverse the order of the characters in the search string.'); writeln(f,' This reverses the order BUT DOES NOT complement characters.'); {qqq} {zzz} writeln(f,'one can type several commands on one line separated by spaces.'); writeln(f,'example (without quotes): "M 1 V n V s V d V p gaattc * ecori"'); writeln(f); answers := 0; repeat if nostring(buffer) then writeln(output,'do you want to see the patterns allowed? (y/n)'); getchar(input, buffer, answer, gotten); gotten := (answer = 'y') or (answer = 'n'); answercheck(answers); until gotten; if answer='y' then begin write (f,'anything else recognizable is a pattern.'); writeln(f,' (the ''s are not needed):'); writeln(f,'the simplest pattern contains only "a", "c", "g", or "t".'); writeln(f,'one can also ask for purines ("r") or pyrimidines ("y").'); writeln(f,'the form "(x/y)" or "(x/y/z)" allows search for "x or y" or'); writeln(f,'"x or y or z". x, y, and z must be "a", "c", "g", or "t".'); writeln(f); writeln(f,'"n" means any base.'); writeln(f,'"e" means an extension: the scan is made with and without'); writeln(f,' the e. during the scan, e is treated like an "n".'); writeln(f,'one may ask for several letters, by stating the number. '); writeln(f,' so "5a" is the same as "aaaaa".'); writeln(f,'"#" the number of the next base is returned on a match.'); writeln(f,' default: the first base beyond n''s and e''s'); writeln(f,' Position of # is changed when complement (~) is taken.'); writeln(f,'"%" the number of the base before the current one is given.'); writeln(f,' % is like #, but does NOT change position when ~ is taken.'); writeln(f,'"<" allow no mismatches until ">"'); writeln(f,'">" allow mismatches until "<" (the default)'); writeln(f,' "aa" makes "cag" searched for exactly.'); writeln(f,'"string" Double quoted string is a name.'); writeln(f,' It starts searchfeatures. Empty string turns it off.'); writeln(f,'"|" symbol that will be put into searchfeatures BETWEEN bases'); writeln(f,'"^" symbol that will be put into searchfeatures BETWEEN bases'); writeln(f,'"[" symbol that will be put into searchfeatures BETWEEN bases'); writeln(f,'"]" symbol that will be put into searchfeatures BETWEEN bases'); writeln(f,'example: "acag(t/c/a)5e#2a<3r3y>".'); writeln(f); answers := 0; repeat answer := ' '; if nostring(buffer) then writeln(output,'do you want to see the relational ', 'patterns allowed? (y/n)'); getchar(input, buffer, answer, gotten); gotten := (answer = 'y') or (answer = 'n'); answercheck(answers); until gotten; if answer='y' then begin writeln(f,'"$" specifies a relation between two bases. the format is:'); writeln(f,' "$#r", where # is a position in the pattern (preceding'); writeln(f,' this position) that is related to this position by r.'); writeln(f,' r must be one of the following: i (identity);'); writeln(f,' ni (non-identity); c (complement); nc (non-complement).'); writeln(f,' w (complement including g-t pair); nw (non-w).'); writeln(f); writeln(f,'examples: "n$1i" would search for aa, cc, gg and tt.'); writeln(f,' "5n$1c" would search for complementary bases '); writeln(f,' separated by 4 unspecified bases.'); writeln(f,' NOTE: this was formerly [before 1997] the ^ symbol.'); end end; clearstring(buffer); (* make sure the buffer does not propagate *) end; (* searchhelp *) procedure showletters(var f: text); (* show to file f the letter conversions of forms like "(x/y)" *) begin (* showletters *) writeln(f,'a is a '); writeln(f,'c is c '); writeln(f,'m is ac '); writeln(f,'g is g '); writeln(f,'r is a g '); writeln(f,'s is cg '); writeln(f,'v is acg '); writeln(f,'t is t'); writeln(f,'w is a t'); writeln(f,'y is c t'); writeln(f,'h is ac t'); writeln(f,'k is gt'); writeln(f,'d is a gt'); writeln(f,'b is cgt'); writeln(f,'n is acgt'); writeln(f,'e is acgt or nothing'); writeln(f,'warning: some of these ambiguous nucleotide symbols overlap '); writeln(f,' some of the search command symbols. for instance, h'); writeln(f,' can mean "a or c or t" or it can mean "help".'); writeln(f,' to avoid problems, begin search patterns with a, c, g,'); writeln(f,' t or n, or use the (x/y/z) form for ambiguous bases.'); end; (* showletters *) procedure Delilahelp(var f: text); (* write out commands in Delila subsystem to file f *) begin (* Delilahelp *) writeln(f,'this is a search subsystem for creating Delila'); writeln(f,'instructions based on search results.'); writeln(f); writeln(f,'q: quit to search.'); writeln(f,'p: print Delila instructions on/off switch.'); writeln(f,' when on, instructions will be printed in searchinst for each'); writeln(f,' pattern found. if n is the value of the numbered (#''d)'); writeln(f,' base, f and t are the values from and to, then the'); writeln(f,' instruction is a get of the form:'); writeln(f,' get from n +f to n +t;'); writeln(f,' organism, chromosome and piece specifications are'); writeln(f,' automatically taken care of.'); writeln(f); writeln(f,'f: set from: number of bases before #''d base to get from'); writeln(f,'t: set to: number of bases after #''d base to get to'); writeln(f,' both from and to are with respect to the piece,'); writeln(f,' so you do not need to worry about orientations.'); writeln(f,'i set instruction type: one or two places in get.'); writeln(f,' insttype=1 means the form get from p -/+f to same +/-t dir +/-;'); writeln(f,' insttype=2 means the form get from p1 -/+f to p2 +/-t dir +/-;'); writeln(f,' where p or p2 are the current location, p1 is the previous,'); writeln(f,' f is the from range and t is the to range.'); writeln(f,' insttype=3 means the form get from p1 -/+f to p2 +/-t dir +/-;'); writeln(f,' where p1 is the current location 5'' end, p2 is the 3'' end,'); writeln(f,'w: to write your own Delila instructions.'); writeln(f,' warning: they are not checked at all.'); writeln(f,' q to quit. common uses: title and defaults.'); writeln(f,'s: show all current Delila instructions'); writeln(f,'k: kill all current Delila instructions'); writeln(f,'h: help (this list).'); write (f,'*: the rest of the line is a comment sent to'); writeln(f, ' the searchinst and result files'); end; (* Delilahelp *) procedure viewhelp(var f: text); (* write to file f the sub-commands for the view command *) procedure state(a: boolean); (* write the state of a out *) begin (* state *) if a then write(f,' on ') else write(f,' '); end; (* state *) begin (* viewhelp *) writeln(f,'the view command sets the amount of search results made visible.'); writeln(f,'the parts correspond to the order of printed results.'); writeln(f,'the current state of the toggle switches available'); writeln(f,'is shown below, along with the commands:'); state(viewt); writeln(f,'t: typed pattern'); state(viewe); writeln(f,'e: expanded pattern'); state(viewi); writeln(f,'i: identification information (organism, etc)'); state(viewf); writeln(f,'f: forms of patterns (with variable e)'); state(views); writeln(f,'s: sequence found'); state(viewp); writeln(f,'p: position of matches on piece'); state(viewd); writeln(f,'d: distance between matches'); state(viewm); writeln(f,'m: matches per piece'); state(viewb); writeln(f,'b: matches per book'); writeln(f); state(false); writeln(f,'a: all results viewed'); state(false); writeln(f,'n: nothing viewed (even total matches)'); state(false); writeln(f,'q: quit view process (do nothing)'); state(false); writeln(f,'h: help (this list)') end; (* viewhelp *) function patternlength(pattern: string): integer; (* give the length of the pattern. *) var p: integer; (* index to pattern *) begin (* showpattern *) p:=1; while pattern.letters[p]<>'.' do begin { write(afile,pattern.letters[p]); } p:=succ(p) end; patternlength := p-1; end; (* patternlength *) procedure showpattern(var afile:text; pattern: string; ln: boolean); (* write the pattern to the file. do line feed depending on ln. *) var p: integer; (* index to pattern *) begin (* showpattern *) write(afile,'"'); p:=1; while pattern.letters[p]<>'.' do begin write(afile,pattern.letters[p]); p:=succ(p) end; write(afile,'"'); if ln then writeln(afile) end; (* showpattern *) procedure expandpattern(var p:string; var ok: boolean; var pp: integer); (* make p into an expanded pattern: all or's and numbers become characters. if ok is false then pp is the position of an error in the pattern p, otherwise it is an aribitrary position in p. *) var t: string; (* temporary string for building absolute format *) tp: integer; (* the position in t *) rbase: integer; (* position of related base *) number: integer; (* the number of times to repeat the unit *) numbers: set of '0'..'9'; letter: char; (* the letter to put into t *) binary: packed array[1..4] of char; (* represents "(x/y)" forms *) expecting: boolean; (* a letter is expected after "(" or "/" *) procedure getnumber(p: string; var pp, number: integer); (* pull out a number from p starting at pp. move pp past the number *) var n, (* a second position in p *) power, (* power of 10 *) increment (* used to calculate the number *) : integer; done: boolean; (* are we done yet? *) begin (* getnumber *) number:=0; while (p.letters[pp] in numbers) do pp:=succ(pp); (* pp is now past the number *) n:=pred(pp); (* n is at the lowest digit *) power:=1; done:=false; repeat case p.letters[n] of '0': increment:=0; '1': increment:=1; '2': increment:=2; '3': increment:=3; '4': increment:=4; '5': increment:=5; '6': increment:=6; '7': increment:=7; '8': increment:=8; '9': increment:=9; end; number:=number+power*increment; power:=power*10; n:=pred(n); if n=0 then done:=true else done:=not(p.letters[n] in numbers) until done; if p.letters[pp]='.' then ok:=false; if number=0 then ok:=false end; (* getnumber *) procedure getrelation; (* we now have a pattern symbol ('$') that specifies a relation between the base at this position and another base. we will now determine what that relation is and to what position it refers. *) var non: boolean; (* means the negation of a specific relation *) begin (* getrelation *) relational := true; non := false; pp := succ(pp); (* get the next letter *) if (p.letters[pp] in numbers) then getnumber(p,pp,rbase) else begin ok := false; writeln(output,' number required after relation symbol'); end; if (p.letters[pp] = 'n') then begin non := true; (* the negation of the relation *) pp := succ(pp); end; if (p.letters[pp] = 'i') then (* identity *) if non then letter := 'p' else letter := 'l' else if (p.letters[pp] = 'c') then (* complementarity *) if non then letter := 'q' else letter := 'j' else if (p.letters[pp] = 'w') then (* complementarity including g-t pairs *) if non then letter := 'z' else letter := 'x' else begin ok := false; if (p.letters[pp] = '.') then writeln(output,'early end to pattern, relation expected') else writeln(output,'illegal relation specified: ',p.letters[pp]); end; end; begin (* expandpattern *) numbers:=['0','1','2','3','4','5','6','7','8','9']; pp:=1; tp:=0; ok:=true; relational := false; (* until we see a relation in the pattern *) while (p.letters[pp]<>'.') and ok do begin if p.letters[pp] in numbers then getnumber(p,pp,number) else number:=1; if ok then begin if p.letters[pp]='(' then begin (* begin "(x/y..." *) expecting:=true; pp:=succ(pp); if p.letters[pp]<>'.' then begin binary:=' '; while (p.letters[pp]<>')') and ok do begin expecting:=false; if p.letters[pp] in ['a','c','g','t'] then begin case p.letters[pp] of 'a': binary[1]:=p.letters[pp]; 'c': binary[2]:=p.letters[pp]; 'g': binary[3]:=p.letters[pp]; 't': binary[4]:=p.letters[pp]; end; end else if p.letters[pp]='.' then begin expecting:=true; ok:=false end else begin ok:=false; writeln(output,'character not in acgt'); end; if ok then begin pp:=succ(pp); if p.letters[pp] <> ')' then if p.letters[pp] = '/' then begin pp:=succ(pp); expecting:=true; (* need char after / *) end else begin ok:=false; writeln(output,'i expected / or )'); end; end end end else begin ok:=false; writeln(output,'unclosed (') end; if expecting then begin ok:=false; writeln(output,'i expect more after ( or /'); pp:=pred(pp) end; if ok then if binary=' ' then ok:=false else if binary='a ' then letter:='a' else if binary=' c ' then letter:='c' else if binary='ac ' then letter:='m' else if binary=' g ' then letter:='g' else if binary='a g ' then letter:='r' else if binary=' cg ' then letter:='s' else if binary='acg ' then letter:='v' else if binary=' t' then letter:='t' else if binary='a t' then letter:='w' else if binary=' c t' then letter:='y' else if binary='ac t' then letter:='h' else if binary=' gt' then letter:='k' else if binary='a gt' then letter:='d' else if binary=' cgt' then letter:='b' else if binary='acgt' then letter:='n' end (* close "(x/y...)" *) else begin if (p.letters[pp] in ['a','c','g','t','n','e','#','%','|','^','[',']','$', 'm','r','w','s','y','k','v','h','d','b']) or (p.letters[pp]='<') or (p.letters[pp]='>') or (p.letters[pp]='^') then letter:=p.letters[pp] else begin ok:=false; writeln(output,'funny character'); end; end; (* if letter = '$' we need to find what relation is specified and to what base it applies *) if (letter = '$') then getrelation else rbase := 0; if ok then begin (* we have the letter now *) while (number<>0) and ok do begin tp:=succ(tp); if tp>=maxstring then begin ok:=false; writeln(output,'expanded pattern too long') end else begin (* store in t *) t.letters[tp]:=letter; if (tp > rbase) then relatedbase[tp] := rbase else begin writeln(output,' related base must', ' preceed relation'); ok := false; end; number:=pred(number) end end; if ok then pp:=succ(pp) end end end; if ok then begin p:=t; (* replace pattern from temporary pattern *) p.letters[tp+1]:='.' (* must end on period *) end end; (* expandpattern *) function complementbase(c: char): char; (* complement the base *) begin if not (c in [ 'a','c','m','g','r','s','v','t','w','y','h','k','d','b','n','%', '<','>','e','#','[',']', '|','^', '(','/',')', '0','1','2','3','4','5','6','7','8','9']) then begin writeln(output,'bad character "',c,'" found during complement'); end else begin case c of 'a': complementbase := 't'; (* is a *) 'c': complementbase := 'g'; (* is c *) 'm': complementbase := 'k'; (* is ac *) 'g': complementbase := 'c'; (* is g *) 'r': complementbase := 'y'; (* is a g *) 's': complementbase := 'w'; (* is cg *) 'v': complementbase := 'b'; (* is acg *) 't': complementbase := 'a'; (* is t *) 'w': complementbase := 's'; (* is a t *) 'y': complementbase := 'r'; (* is c t *) 'h': complementbase := 'd'; (* is ac t *) 'k': complementbase := 'm'; (* is gt *) 'd': complementbase := 'h'; (* is a gt *) 'b': complementbase := 'v'; (* is cgt *) 'n': complementbase := 'n'; (* is acgt *) '<': complementbase := '>'; (* start of match *) '>': complementbase := '<'; (* end of match *) 'e': complementbase := 'e'; (* expand *) '(': complementbase := ')'; (* parens reverse *) ')': complementbase := '('; (* parens reverse *) '%','#','|','^','0','1','2','3','4','5','6','7','8','9', '[',']', (* bracket does not change *) '/' (* slash does not change *) {zzz} : complementbase := c end end end; (* complementbase *) procedure stringcomplement(var p: string); (* create the complement of the string p *) (* when numbered strings of the form 32n or #5 (not %) are found, the substring (32n or #5) must not be reversed in order. The machinery below does this by keeping track of the start and stop points of every string found. *) var h: string; (* for holding the p string *) i: integer; (* index to the strings *) j: integer; (* index to the strings *) endofflip: boolean; (* true if the end of a numbered region is found *) flipnumber: boolean; (* true if there is a number to be flipped *) upper: integer; (* a constant to make things a bit faster *) start: integer; (* start of a flipped region *) stop: integer; (* stop of a flipped region *) begin clearstring(h); h.length := p.length; flipnumber := false; upper := p.length+1; for i := 1 to p.length do begin endofflip := true; stop := i; h.letters[upper-i] := complementbase(p.letters[i]); if p.letters[i] in ['#','0','1','2','3','4','5','6','7','8','9'] then begin endofflip := false; if not flipnumber then begin flipnumber := true; start := i end end; { write(output,'before flip: "');writestring(output,h); writeln(output,'"'); } if endofflip and flipnumber then begin (* move the entire number and the next base without turning it around *) { writeln(output,'endofflip'); } for j := start to stop do h.letters[(upper-stop)+(j-start)] := complementbase(p.letters[j]); flipnumber := false end { ;write(output,' after flip: "');writestring(output,h); writeln(output,'"'); } end; copystring(h,p); write(output,'* the complementary search string is now: "'); writestring(output,p); writeln(output,'"'); write(result,'* the complementary search string is now: "'); writestring(result,p); writeln(result,'"'); if printinginstructions then begin write(searchinst,'(* the complementary search string is now: "'); writestring(searchinst,p); writeln(searchinst,'" *)'); end; {yyy} { halt; } end; {qqq} procedure stringreverse(var p: string); (* Reverse the order of the string p WITHOUT taking the complement. No symbols are altered. *) var upper: integer; (* a constant to make things a bit faster *) i: integer; (* index to the string *) midpoint: integer; (* half of the string length *) hold: char; (* a character in the string *) begin upper := p.length+1; midpoint := p.length div 2; for i := 1 to midpoint do begin hold := p.letters[i]; p.letters[i] := p.letters[upper-i]; p.letters[upper-i] := hold; end; write(output,'* the reversed search string is now: "'); writestring(output,p); writeln(output,'"'); write(result,'* the reversed search string is now: "'); writestring(result,p); writeln(result,'"'); if printinginstructions then begin write(searchinst,'(* the reversed search string is now: "'); writestring(searchinst,p); writeln(searchinst,'" *)'); end; end; (* stringreverse *) {qqq} procedure stringinvert(var p: string); (* complement each letter in the string. The order is not changed. *) var i: integer; (* index to the string *) begin for i := 1 to p.length do begin p.letters[i] := complementbase(p.letters[i]); end; write(output,'* the inverted (complement only) search string is now: "'); writestring(output,p); writeln(output,'"'); write(result,'* the inverted (complement only) search string is now: "'); writestring(result,p); writeln(result,'"'); if printinginstructions then begin write(searchinst,'(* the inverted (complement only)', ' search string is now: "'); writestring(searchinst,p); writeln(searchinst,'" *)'); end; end; (* stringinvert *) procedure analysepattern(var p,e: string; var ok: boolean); (* the pattern is forced to end in a blank, and it is expanded into e. ok is true when no errors were found. *) var n: integer; (* position in p *) elate: boolean; (* e on end of pattern *) numofnums: integer; (* number of # symbols *) error: string; (* used to show an error *) begin(* analysepattern *) clearstring(error); ok:=true; (* locate periods in pattern *) for n:=1 to p.length do if p.letters[n]='.' then begin ok := false; (* The original convention in search.p was to define the end of the string with '.'. Make it possible to change/upgrade this by supplying the length *) p.length := n - 1; end; {zzzsss} if not ok then writeln(output,'no periods (.) allowed in the search pattern'); if p.length+1 <= maxstring then with p do letters[length+1] := '.' else begin ok:= false; writeln(output,'search string is too long') end; (* begin expansion *) e:=p; (* find last possible e *) (* do it now since we know end: length *) n:=p.length; while (n<>1) and ((e.letters[n] in ['0','1','2','3','4','5','6','7','8','9']) or (e.letters[n]='#') or (e.letters[n]='%') or (e.letters[n]='<') or (e.letters[n]='>') or (e.letters[n]='|') or (e.letters[n]='^') or (e.letters[n]='[') or (e.letters[n]=']') ) do n:=pred(n); if e.letters[n]='e' then begin ok:=false; error.letters[n]:='e'; elate:=true end else elate:=false; if ok then begin expandpattern(e,ok,n); if not ok then error.letters[n]:='^' end; (* find first possible e. this is done here since expandpattern removes numbers, making it easy to spot a prefixed e *) n:=1; while ((e.letters[n]='#') or (e.letters[n]='%') or (e.letters[n]='<') or (e.letters[n]='>') or (e.letters[n]='|') or (e.letters[n]='^') or (e.letters[n]='[') or (e.letters[n]=']') or (e.letters[n]='(') or (e.letters[n]=')') or (e.letters[n]='$') or (e.letters[n]='/') ) {zzzddd} and (n '.' do begin if (e.letters[n]='#') or (e.letters[n]='%') then numofnums:=succ(numofnums); n:=succ(n) end; if numofnums>1 then begin writeln(output,'extra # or % symbols'); ok:=false; error.letters[n-1]:='#'; end; if (e.letters[pred(n)]='#') or (e.letters[pred(n)]='%') then begin { writeln(output,'# symbol not allowed at end'); ok:=false; error.letters[n-1]:='#'; } writeln(output,'# or % symbol found at end: adding n to end'); if succ(p.length) > maxstring then begin writeln(output,'... that makes the string too long'); ok:=false; error.letters[n-1]:='#'; end else begin p.length := succ(p.length); p.letters[p.length] := 'n'; p.letters[p.length+1] := '.'; e.length := p.length; e.letters[e.length] := 'n'; e.letters[e.length+1] := '.'; end end; (* make sure it is not all n's, e's, <'s, >'s, #'s and %'s *) n:=1; while (e.letters[n] in ['n','e']) or (e.letters[n]='$') or {zzzddd} (e.letters[n]='<') or (e.letters[n]='>') or (e.letters[n]='#') or (e.letters[n]='%') or (e.letters[n]='|') or (e.letters[n]='^') or (e.letters[n]='[') or (e.letters[n]=']') or (e.letters[n]='(') or (e.letters[n]=')') or (e.letters[n]='/') do n:=succ(n); if e.letters[n]='.' then begin ok:=false; error.letters[n-1]:='&'; writeln(output,'You must have other characters in addition to:', ' ne$<>#%|^[]'); end; if ok then begin if viewt then begin writeln(output); write(output,' typed pattern: '); showpattern(output,p,true); write(result,'* typed pattern: '); showpattern(result,p,true); end; if viewe then begin write(output,'expanded pattern: '); showpattern(output,e,true); write(result,'* expanded pattern: '); showpattern(result,e,true); end; if printinginstructions then begin writeln(searchinst); write(searchinst,'(* typed pattern: '); showpattern(searchinst,p,false); writeln(searchinst,' *)') end end else begin (* write a message out for errors *) (* get . for error from pattern *) n:=1; while e.letters[n]<>'.' do n:=succ(n); error.letters[n]:='.'; showpattern(output,e,true); showpattern(output,error,false); writeln(output,' unusable pattern'); (* ignore further commands on the line: *) clearstring(buffer) end end; (* analysepattern *) procedure compress(var p: string; s: integer; var rb: intarray); (* remove from p the character pointed to by s and shift the rest of the pattern to the left *) var ss: integer; (* successor of s *) begin (* compress *) while p.letters[s] <> '.' do begin ss:=succ(s); p.letters[s]:=p.letters[ss]; rb[s] := rb[ss]; s:=ss end; p.length := ss; end;(* compress *) function related(b1, b2: base; r : char): boolean; (* true if b1 and b2 are related as specified by r *) begin case r of (* identity *) 'l' : related := (b1 = b2); (* non-identity *) 'p' : related := (b1 <> b2); (* complementarity *) 'j' : related := (b1 = complement(b2)); (* non-complementary *) 'q' : related := (b1 <> complement(b2)); (* complementarity including g-t pairs *) 'x' : related := ( (b1 = complement(b2)) or ((b1 = g) and (b2 = t)) or ((b1 = t) and (b2 = g)) ); (* non-complementarity, including g-t pairs *) 'z' : related := ( (b1 <> complement(b2)) and not ((b1 = g) and (b2 = t)) and not ((b1 = t) and (b2 = g)) ); end; end; procedure match(pattern: string; mismax: integer; relatedbase: intarray; var org: orgkey; var orgchange: boolean; var chr: chrkey; var chrchange: boolean; var pie: pieceptr; var piechange: boolean; patterncomplement: boolean); (* if true, reverse inst's *) (* match this exact pattern in pie, allow mismax mismatches *) var (* for scanning piece *) i: integer; (* internal position on piece *) length: integer; (* length of this piece *) searchlength: integer; (* the actual length of dna to search *) ba: base; (* a base in the piece *) equal: boolean; (* the pattern is equal to the piece at this place *) startdna, (* the first dnastring in the piece *) currentdna: dnaptr; (* where we are *) cd: dnarange; (* index to currentdna *) subcurrentdna: dnaptr; (* the place we are checking *) subcd: dnarange; (* index to subcurrentdna *) (* pointers in pattern *) patstart, patstop, (* the pattern with n's and e's removed from ends *) patspot: (* the location in between (inclusive) patstart and patstop or a spot in general on the pattern *) integer; (* for matches *) patmatches: integer; (* number of pattern matches on this piece *) j: integer; (* internal coordinate position of first letter in pattern *) blank: boolean; (* put a blank at that spot (when outside the piece) *) realpattern: string; (* the dna in the piece corresponding to pattern *) circle: boolean; (* configuration of the piece (for speed) *) locrecord, (* the location in pattern to record: # and % command *) theplace, (* the actual place on the pattern recorded # and % *) pieceplace, (* like theplace, but on the piece *) internalplace, (* internal coordinate location for pieceplace *) firstinternalplace, (* the internal coordinate of the first match *) lastinternalplace, (* the internalplace matched before this one *) distance: (* the distance to last match or -1 *) integer; (* for mismatches *) fail: boolean; (* fail to match the piece *) mismatches: integer; (* the actual number of mismatches *) mispattern: string; (* the places mismatches occured *) blankpattern: string; (* for clearing mispattern rapidly *) (* where mismatches are allowed: *) allowmismatch: packed array[1..maxstring] of boolean; allowed: boolean; (* used to build allowmismatch *) firsttime: boolean; (* the first time a match is found, the piece name instruction is written; otherwise be silent *) r: integer; (* index for reversing feature string *) procedure display(var afile: text); (* display the match. global variables used: realpattern, mismatches, theposition, pieceplace *) var p: integer; begin (* display *) if views then begin write(afile,' '); showpattern(afile,realpattern,true); (* show mismatches *) if mismax<>0 then begin write(afile,' '); showpattern(afile,mispattern,false); { writeln(afile,' ',mismatches:1,' mismatche(s)') } write(afile,' ',mismatches:1,' mismatch'); if mismatches <> 1 then write(afile,'s'); writeln(afile); end; if viewp then begin (* mark location *) write(afile,' '); for p:=1 to theplace do write(afile,' '); (* 0->1 1990 Sep 4 *) write(afile,'^ ',pieceplace:1,' ') {yyy} end end else if viewp then write(afile,' ',pieceplace:6); if viewd then if distance > 0 then write(afile,' ',distance:6,' bases from last match '); if views or viewd or viewp then writeln(afile,'*') end; (* display *) begin (* match *) firsttime := true; (* In this part we check the special case in which a search string begins with [ or ends with ]. In these cases, remove the given so that it can be replaced BETWEEN letters *) { showpattern(output,pattern,false); zzzsss this seems unnecessary! } if (pattern.letters[1]='[') then begin with thedefinition^ do begin posparts.letters[1] := '-'; end end; {zzzNNN} (* Do the same thing for the right side *) (* find the end of the string in patspot *) patspot := 1; while pattern.letters[patspot]<>'.' do patspot := succ(patspot); if (pattern.letters[patspot-1] = ']') then begin with thedefinition^ do begin posparts.letters[2] := '-'; end end; {zzzsss} { writeln(output); write(output,'BEFORE ---> "'); writeadefinition(output,thedefinition); writeln(output,'"'); } (* extract # and % command and mismatch areas *) locrecord := 1; allowed := true; patspot := 1; poundsign := false; while pattern.letters[patspot]<>'.' do begin if (pattern.letters[patspot]='<') or (pattern.letters[patspot]='>') or (pattern.letters[patspot]='#') or (pattern.letters[patspot]='%') or (pattern.letters[patspot]='|') or (pattern.letters[patspot]='^') or (pattern.letters[patspot]='[') or (pattern.letters[patspot]=']') then begin if (pattern.letters[patspot]='#') then poundsign := true; {if poundsign then writeln(output,'POUNDSIGN FOUND') else writeln(output,'no POUNDSIGN found'); zzzsss} if pattern.letters[patspot]='#' then locrecord:=patspot else if pattern.letters[patspot]='%' then locrecord:=patspot-1 else if pattern.letters[patspot]='<' then allowed:=false else if pattern.letters[patspot]='>' then allowed:=true; if dosearchfeatures then with thedefinition^ do begin if (pattern.letters[patspot]='#') or (pattern.letters[patspot]='%') or (pattern.letters[patspot]='|') or (pattern.letters[patspot]='^') or (pattern.letters[patspot]='[') or (pattern.letters[patspot]=']') then if not featureinserts then with thedefinition^ do begin marks := succ(marks); with posparts do begin (* move end mark out *) length := succ(length); letters[length] := letters[length-1]; letters[length-1] := pattern.letters[patspot]; end; (* the location is relative to the current one For '%', the location to put the % is between bases hence there is a subtraction of 0.5. *) if (pattern.letters[patspot]='%') or (pattern.letters[patspot]='[') or (pattern.letters[patspot]=']') then locations[posparts.length-1] := patspot - locrecord - 0.5 else locations[posparts.length-1] := patspot - locrecord; (* Note: "EcoRI0" #gaattc "EcoRI1" g#aattc "EcoRI2" ga#attc "EcoRI3" gaa#ttc "EcoRI4" gaat#tc "EcoRI5" gaatt#c "EcoRI6" gaattc# The last two of this series are handled a bit oddly. Ecori5 gives no # and 6 extends the length. This may never matter... *) (* vertical bar is between bases *) if (pattern.letters[patspot]='|') or (pattern.letters[patspot]='^') then locations[posparts.length-1] := locations[posparts.length-1] - 0.5; (* do negparts here *) with negparts do begin (* move end mark out *) length := succ(length); letters[length] := letters[length-1]; letters[length-1] := pattern.letters[patspot]; end; (* the middle part of the string has to be reversed *) for r := 2 to posparts.length-1 do begin negparts.letters[(posparts.length-1)-r + 2] := posparts.letters[r]; end end; end; compress(pattern,patspot,relatedbase) end else begin allowmismatch[patspot]:=allowed; patspot:=succ(patspot) end end; pattern.length := patspot; (* that's the current length *) {zzzsss} { write(output,'AFTER ---> "'); writeadefinition(output,thedefinition); writeln(output,'"'); } if dosearchfeatures then with thedefinition^ do begin (* pattern.length includes ".", the definition runs from zero up, so subtract 1: *) { zzzsss} { writeln(output,'****> locrecord: ',locrecord:1); writeln(output,'****> locations[1]: ',locations[1]:1:1); writeln(output,'****> marks: ',marks:1); writeln(output,'****> pattern.length: ',pattern.length:1); } (* only do this once per feature! *) if not featureinserts then begin { writeln(output,'***** DONE'); } locations[1] := 1 - locrecord; locations[marks] := (pattern.length-1) - locrecord; end; featureinserts := true; { } {zzzfff} { writeln(searchfeatures,'in match'); writeln(searchfeatures,'pattern.length = ',pattern.length:1); writeln(searchfeatures,'length = ',length:1); writeln(searchfeatures); writeln(searchfeatures,'* THE CURRENT FEATURE DEFINITION at match IS:'); write(output,'DOUBLE AFTER ---> "'); writeadefinition(output,thedefinition); writeln(output,'"'); } end; (* display pattern form *) if viewf then begin write(output,' '); (* spaces to match the comment in results *) showpattern(output,pattern,true); write(result,'* '); showpattern(result,pattern,true) end; (* find pattern w/o n's or e's on ends *) (* find start of pattern *) patstart:=1; (* if this search contains a relation, we must use all of it, even beginning n's, otherwise we can skip them *) if not relational then while pattern.letters[patstart] in ['n','e'] do patstart:=succ(patstart); (* find end of pattern *) patstop:=patstart; while pattern.letters[patstop]<>'.' do patstop:=succ(patstop); (* find end of pattern without n's or e's *) while pattern.letters[patstop] in ['.','n','e'] do patstop:=pred(patstop); (* calculate length of dna *) if pie = nil then begin writeln(output,'PROGRAM ERROR: empty DNA POINTER!'); halt; end; length:=pietoint(pie^.key.pieend,pie); (* calculate length of dna to search *) case pie^.key.piecon of linear: searchlength:=length-(patstop-patstart); circular: searchlength:=length end; (* set up dna for stepbase *) startdna:=pie^.dna; currentdna:=startdna; cd:=0; (* decide configuration *) circle:=(pie^.key.piecon=circular); (* clear blank pattern *) patspot:=1; while pattern.letters[patspot]<>'.' do begin blankpattern.letters[patspot]:=' '; patspot:=succ(patspot); end; blankpattern.letters[patspot]:='.'; (* last one *) blankpattern.length:=patspot-1; {FFF} (* search the piece for the pattern *) patmatches:=0; lastinternalplace:=0; (* start nowhere *) distance := -1; (* no previous match to calculate distance with *) (* now move to the correct start *) for i := 2 to startpoint do ba := stepbase(startdna,currentdna,cd); i := startpoint; (* the user defined start *) while i <= searchlength do begin patspot:=patstart; subcurrentdna:=currentdna; subcd:=cd; fail:=false; mismatches:=0; mispattern:=blankpattern; realpattern := blankpattern; repeat (* until the pattern matches or doesn't *) ba:=stepbase(startdna,subcurrentdna,subcd); if relational then realpattern.letters[patspot] := basetochar(ba); with pattern do if (letters[patspot] in ['l','p','j','q','x','z']) then equal := related(ba, chartobase(realpattern.letters[relatedbase[patspot]]), letters[patspot]) else case ba of a: equal:= letters[patspot] in ['a','m','r','v','w','h','d','n','e']; c: equal:= letters[patspot] in ['c','m','s','v','y','h','b','n','e']; g: equal:= letters[patspot] in ['g','r','s','v','k','d','b','n','e']; t: equal:= letters[patspot] in ['t','w','y','h','k','d','b','n','e']; end; if not equal then begin mismatches:=succ(mismatches); mispattern.letters[patspot]:='x'; { mispattern.length := patspot; zzzFFF } if allowmismatch[patspot] then fail:= (mismatches>mismax) else fail:= true end; patspot:=succ(patspot) until fail or (patspot=succ(patstop)); if not fail then begin (* yahoo got un *) patmatches:=succ(patmatches); (* tally up *) theplace:=locrecord; patspot:=1; (* pull out the real pattern *) repeat (* internal coordinate position at a letter in pattern *) j:=i-(patstart-patspot); blank:=false; (* take care of pattern off end of piece *) if j<1 then if circle then while j<1 do j:=j+length else blank:=true else if j>length then if circle then while j>length do j:=j-length else blank:=true; (* get the real pattern *) if blank then realpattern.letters[patspot]:=' ' else realpattern.letters[patspot]:=basetochar(getbase(j,pie)); if patspot=locrecord then begin theplace:=patspot; if blank then if patspot 0 then begin (* this instruction type gives distances between sites *) if patterncomplement then begin iwget2(searchinst,pie, -fromplace,inttopie(lastinternalplace,pie), -toplace, pieceplace, not flip, true); { writeln(output,'second iwget2 not flip'); } end else begin iwget2(searchinst,pie, fromplace,inttopie(lastinternalplace,pie), toplace, pieceplace, flip, true); { writeln(output,'second iwget2 flip'); } end { if patterncomplement then iwget2(searchinst,pie, fromplace,inttopie(lastinternalplace,pie), toplace, pieceplace, not flip, true) else iwget2(searchinst,pie, fromplace,inttopie(lastinternalplace,pie), toplace, pieceplace, flip, true); } end; 3: begin (* this instruction type gives the current search string *) if patterncomplement then begin {zzzbbb to be done} { iwget2(searchinst,pie, -fromplace,inttopie(lastinternalplace,pie), -toplace, pieceplace, not flip); } iwget2(searchinst,pie, -fromplace, pieceplace, -toplace, inttopie ( pietoint(pieceplace,pie) + patternlength(pattern) - 1, pie), not flip, true); {writeln(output,'second iwget2 not flip');} end else begin { writeln(output,'patternlength(e) = ',patternlength(e):1); writeln(output,'currentpatternlength = ',currentpatternlength:1); writeln(output,'patternlength(pattern) = ',patternlength(pattern):1); } iwget2(searchinst,pie, fromplace, pieceplace, toplace, inttopie ( pietoint(pieceplace,pie) + patternlength(pattern) - 1, pie), flip, true); { writeln(output,'second iwget2 flip'); } end end; end; end; if dosearchfeatures then begin (* only put out named features *) if thedefinition^.nametag.length > 0 then begin (* put out the definition if this is the first time *) if not featuredefwritten then begin writeln(searchfeatures); (* show the string *) write(searchfeatures,'* '); writestring(searchfeatures, pattern); writeln(searchfeatures); writeadefinition(searchfeatures, thedefinition); writeln(searchfeatures); featuredefwritten := true; end; (* put out the searchfeatures file *) nametostring(pie^.key.hea.keynam, thefeature^.id); { 2004 July 18: This compiled before gpcc, but the types are different!! thefeature^.id := pie^.key.hea.keynam; } (* The orientation of the feature as searched is the same as the orientation of the piece UNLESS WE FLIPPED TO COMPLEMENT!! *) if patterncomplement then begin if pie^.key.piedir = plus then thefeature^.orientation := -1 else thefeature^.orientation := +1 end else begin if pie^.key.piedir = plus then thefeature^.orientation := +1 else thefeature^.orientation := -1 end; (* we have to keep track of whether the feature was in the same or a different orientation from the piece so that its end coordinate can be set correctly *) { original code: if ((thefeature^.orientation = +1) and (pie^.key.piedir = minus)) or ((thefeature^.orientation = -1) and (pie^.key.piedir = plus)) if poundsign then writeln(output,'POUNDSIGN FOUND') else writeln(output,'no POUNDSIGN found'); } if (((thefeature^.orientation = +1) and (pie^.key.piedir = minus)) or ((thefeature^.orientation = -1) and (pie^.key.piedir = plus)) ) and (not poundsign) then begin (* shift it so it covers the right region *) (* THERE IS NO NEED TO SHIFT IF THE # MECHANISM IS IN PLAY! In that case the exact location has already been determined. *) {zzzaaa} { writeln(output,'~~~~~~thefeature^.definition^.marks:', thefeature^.definition^.marks:1); writeln(output,'~~~~~~thefeature^.definition^.locations[1]:', thefeature^.definition^.locations[1]:1:1); writeln(output,'~~~~~~thefeature^.definition^.locations[thefeature^.definition^.marks]:', thefeature^.definition^.locations[thefeature^.definition^.marks]:1:1); } {zzzsss} thefeature^.coordinate := inttopie(internalplace + round(- thefeature^.definition^.locations[1] + thefeature^.definition^.locations [thefeature^.definition^.marks]) ,pie); { writeln(output,'~~~~~~thefeature^.coordinate:', thefeature^.coordinate:1:1); } { writeln(output,'=================>flip'); } end else thefeature^.coordinate := inttopie(internalplace,pie); { write(output,'thedefinition:::::::::'); writeadefinition(output, thedefinition); writeln(output); --- writeln(output,'thefeature^.coordinate = ', thefeature^.coordinate:1:1); writeln(output,'thefeature^.definition^.min = ', thefeature^.definition^.min:1:1); writeln(output,'thefeature^.definition^.max = ', thefeature^.definition^.max:1:1); writeln(output,'thefeature^.definition^.locations[1] = ', thefeature^.definition^.locations[1]:1:1); writeln(output,'thefeature^.definition^.locations[2] = ', thefeature^.definition^.locations[2]:1:1); writeln(output,'thedefinition^.min = ', thedefinition^.min:1:1); writeln(output,'thedefinition^.max = ', thedefinition^.max:1:1); writeln(output,'thedefinition:'); writeadefinition(output, thedefinition); writeln(output); writeln(output); } { if patterncomplement then thefeature^.orientation := -thefeature^.orientation; the above is not the right code to use } dofeatures(searchfeatures, mismatches, pattern, mispattern, thefeature, thedefinition, patterncomplement); (* writeln(output,'dofeatures ==========================='); {yyy} *) end; end; end; (* move to next position in piece *) i := i + shift; for j := 1 to shift (* use j as an index to advance the position *) do ba:=stepbase(startdna,currentdna,cd) end; bookmatches := bookmatches + patmatches; (* handle circular case for distances *) if viewd then if (pie^.key.piecon = circular) and (patmatches > 0) then begin distance := (piecelength(pie) - internalplace) + firstinternalplace; writeln(output,'circle closing distance: ',distance:1); writeln(result,'* circle closing distance: ',distance:1); end; if viewm then begin write(output,' ',patmatches:1); if (patmatches = 1) then writeln(output,' match in piece') else writeln(output,' matches in piece'); writeln(output); write(result,' ',patmatches:1); if (patmatches = 1) then writeln(result,' match in piece') else writeln(result,' matches in piece'); writeln(result,'*************') end end; (* match *) procedure multi(pattern: string; mismax: integer; relatedbase: intarray; var org: orgkey; var orgchange: boolean; var chr: chrkey; var chrchange: boolean; var apiece: pieceptr; var piechange: boolean; patterncomplement: boolean); (* if true, reverse delila inst's *) (* make multiple calls to match, allow mismax mismatches *) procedure reduce(pattern: string; place: integer; relatedbase: intarray); (* reduce the pattern by some e's, and recurse *) var subplace: integer; begin (* reduce *) while not (pattern.letters[place] in ['e','.']) do place:=succ(place); if pattern.letters[place]='.' then match(pattern,mismax,relatedbase, (* no more e's *) org,orgchange,chr,chrchange,apiece,piechange, patterncomplement) else begin (* at an e *) repeat (* removing e's and recursing *) subplace:=place; (* find end of e's *) while pattern.letters[subplace]='e' do subplace:=succ(subplace); (* do everything to the right *) reduce(pattern,subplace,relatedbase); (* remove one e *) compress(pattern,place,relatedbase) until pattern.letters[place]<>'e'; reduce(pattern,place,relatedbase); (* do pattern without e's *) end end; (* reduce *) begin (* multi *) reduce(pattern,1,relatedbase) end; (* multi *) procedure multimatch(pattern: string; var book: text; mismax: integer; var org: orgkey; (* the current organism *) var chr: chrkey; (* the current chromosome *) var pie: pieceptr; (* the current piece *) var orgchange, chrchange, piechange: boolean; (* that either changed *) var orgopen, chropen, pieopen: boolean; (* used by getocp *) var sorgchange, schrchange, spiechange: boolean; (* that either changed *) var sorgopen, schropen, spieopen: boolean; (* who is open in searchinst *) patterncomplement: boolean); (* if true, reverse delila inst's *) (* try to match the pattern to each piece in book allow mismax mismatches *) var piecesinbook: integer; (* count the number of pieces in the book. If there is only one, then set reusethepiece true so that we no longer read the book *) (* ooo *) { org: orgkey; (* the current organism *) chr: chrkey; (* the current chromosome *) orgchange, chrchange: boolean; (* that either changed *) orgopen, chropen, pieopen: boolean; (* used by getocp *) pie: pieceptr; } procedure showpiece(var afile: text; pie: pieceptr); (* show the information for the piece *) begin (* showpiece *) with pie^.key do begin with hea.keynam do write(afile,' piece: ',letters:length,','); if numbered then write(afile,' #',number:1,','); write(afile,' configuration: '); if piecon=linear then write(afile,'linear,') else write(afile,'circular,'); write(afile,' direction: '); if piedir=plus then write(afile,'+,') else write(afile,'-,'); write(afile,' begin: ',piebeg: 1,',', ' end: ', pieend:1); writeln(afile) end end; (* showpiece *) begin (* multimatch *) reset(book); {ooo new(pie); orgopen:=false; chropen:=false; pieopen:=false; } sorgopen:=false; schropen:=false; spieopen:=false; bookmatches := 0; theline := 1; piecesinbook := 0; while ((not reusethepiece) and (not eof(book))) or (reusethepiece and (piecesinbook < 1)) do begin {writeln(output,'multimatch 1: piechange=',piechange);} if not reusethepiece then getocp(book,theline,org,orgchange,orgopen, chr,chrchange,chropen, pie,piechange,pieopen) else begin {writeln(output,'all change variables MADE FALSE'); zzz} {christmas zzzccc the effect of deleting these is that the org/chr/pie insts are now given when not needed! } orgchange := false; chrchange := false; piechange := false end; {zzz writeln(output,'multimatch 2: piechange=',piechange);} if not eof(book) then begin piecesinbook := succ(piecesinbook); if viewi then begin (* show organism and chromosome *) {OOO} iworgchr(output,org,sorgchange,sorgopen, chr,schrchange,schropen); if sorgchange or schrchange then write(result,'* '); { (* 2001 Sep 7 *) if sorgchange or schrchange then spiechange := true else spiechange := false; } iworgchr(result,org,sorgchange,sorgopen, chr,schrchange,schropen); (* show piece *) showpiece(output,pie); writeln(result,'*'); (* put space from the previous one *) write(result,'*'); (* removed space 1990 Sep 4 *) showpiece(result,pie); end; (* write the org, chr and pie instructions ONLY once the first one has been found!!! So the following is not used: ... 2012 May 08 add it back and update it. *) if printinginstructions then begin { writeln(searchinst,'(','* iworgchr being called from multimatch zzz *',')'); } (* writeln(searchinst,'{sorgchange: ', sorgchange ,' BUBBA}'); writeln(searchinst,'{schrchange: ', schrchange ,' BUBBA}'); writeln(searchinst,'{sorgopen : ', sorgopen ,' BUBBA}'); writeln(searchinst,'{schropen : ', schropen ,' BUBBA}'); *) sorgopen := not sorgopen; schropen := not schropen; iworgchr(searchinst,org,sorgchange,sorgopen, chr,schrchange,schropen); if piechange then iwpie(searchinst,pie^.key); end; if orgchange then clearheader(org.hea); if chrchange then clearheader(chr.hea); multi(pattern,mismax,relatedbase, org,orgchange,chr,chrchange, pie,piechange, (* pass to allow silence when not found *) patterncomplement); (* the old location: clearpiece(pie) *) end end; if not reusethepiece then if piecesinbook = 1 then begin reusethepiece := true; writeln(output,'(reusing the single piece in the book for efficiency)'); reset(book); (* fool it into doing the loop above ... *) end; (* the old location: dispose(pie); *) if viewb then begin write(output,' ',bookmatches:1); if (bookmatches = 1) then writeln(output,' match in book') else writeln(output,' matches in book'); writeln(output); write(result,'* ',bookmatches:1); if (bookmatches = 1) then writeln(result,' match in book') else writeln(result,' matches in book'); writeln(result,'**********************') (* space result file a bit *) end end; (* multimatch *) procedure instheader; (* make header for instruction file *) begin (* instheader *) rewrite(searchinst); write(searchinst,'title "'); writedatetime(searchinst,datetime); writeln(searchinst,' search ',version:4:2,'";'); iwcombk(book,searchinst); (* no longer needed - these are defaults for delila writeln(searchinst,'default numbering piece;'); writeln(searchinst,'default numbering 1;'); *) writeln(searchinst,'set out-of-range reduce-range;'); end; (* instheader *) procedure copyfile(var fromfile, tofile: text; space: boolean); (* copy one file into the other. no resets or rewrites are done. if space is true, then put an '* ' before each line. *) begin (* copyfile *) while not eof(fromfile) do begin if space then write(tofile,'* '); copyaline(fromfile, tofile) end end; (* copyfile *) procedure getmismatches; (* obtain a new value of the global variable, mismatches *) var newmismatches: integer; (* the value the person typed *) begin (* getmismatches *) answers := 0; repeat if nostring(buffer) then writeln(output,'mismatches were ', mismatches:1,', type new:'); getinteger(input,buffer,newmismatches,gotten); if gotten then if newmismatches < 0 then begin writeln(output,'type zero or a positive integer'); clearstring(buffer); gotten := false end; answercheck(answers); until gotten; mismatches := newmismatches; writeln(result,'* maximum number of mismatches now allowed: ', mismatches:1) end; (* getmismatches *) {ppp} procedure getcolorbackground; (* obtain a new value of the color background for letters. This is called by the C command *) var newTparam: char; (* the value the person typed *) newparam: real; (* the value the person typed *) begin (* getcolorbackground *) with thefeature^ do begin (* Tparam *) answers := 0; repeat if nostring(buffer) then writeln(output,'Tparam was "', Tparam:1,'", type new (allowed: "hrHR"):'); getchar(input,buffer,newTparam,gotten); if gotten then if not (newTparam in ['h','r','H','R']) then begin writeln(output,'Tparam must be one of " hrHR"'); clearstring(buffer); gotten := false end; answercheck(answers); until gotten; Tparam := newTparam; writeln(result,'* Tparam colorbackground: ', Tparam:1); (* Aparam *) answers := 0; repeat if nostring(buffer) then writeln(output,'Aparam was ', Aparam:infofield:infodecim,', type new:'); getreal(input,buffer,newparam,gotten); if gotten then if newparam < 0 then begin writeln(output,'type zero or a positive integer'); clearstring(buffer); gotten := false end; answercheck(answers); until gotten; Aparam := newparam; writeln(result,'* Aparam colorbackground: ', Aparam:infofield:infodecim); (* Bparam *) answers := 0; repeat if nostring(buffer) then writeln(output,'Bparam was ', Bparam:infofield:infodecim,', type new:'); getreal(input,buffer,newparam,gotten); if gotten then if newparam < 0 then begin writeln(output,'type zero or a positive integer'); clearstring(buffer); gotten := false end; answercheck(answers); until gotten; Bparam := newparam; writeln(result,'* Bparam colorbackground: ', Bparam:infofield:infodecim); (* Cparam *) answers := 0; repeat if nostring(buffer) then writeln(output,'Cparam was ', Cparam:infofield:infodecim,', type new:'); getreal(input,buffer,newparam,gotten); if gotten then if newparam < 0 then begin writeln(output,'type zero or a positive integer'); clearstring(buffer); gotten := false end; answercheck(answers); until gotten; Cparam := newparam; writeln(result,'* Cparam colorbackground: ', Cparam:infofield:infodecim); (* Dparam *) answers := 0; repeat if nostring(buffer) then writeln(output,'Dparam was ', Dparam:infofield:infodecim,', type new:'); getreal(input,buffer,newparam,gotten); if gotten then if newparam < 0 then begin writeln(output,'type zero or a positive integer'); clearstring(buffer); gotten := false end; answercheck(answers); until gotten; Dparam := newparam; writeln(result,'* Dparam colorbackground: ', Dparam:infofield:infodecim); end; end; (* getcolorbackground *) { un built procedure - could dump 2004 jul 18 procedure getcolorletters; (* obtain a new value of the color letters for letters. This is called by the C command *) var newcolorletters: integer; (* the value the person typed *) begin (* getcolorletters *) answers := 0; repeat if nostring(buffer) then writeln(output,'colorletters were ', colorletters:1,', type new:'); getinteger(input,buffer,newmismatches,gotten); if gotten then if newmismatches < 0 then begin writeln(output,'type zero or a positive integer'); clearstring(buffer); gotten := false end; answercheck(answers); until gotten; colorletters := newcolorletters; writeln(result,'* maximum number of colorletters now allowed: ', colorletters:1) end; (* getcolorletters *) } procedure toggleoktosearch; (* toggle the oktosearch variable *) begin oktosearch := not oktosearch; if oktosearch then begin writeln(result,'* searches will proceed when pattern is input', ' or with the = command'); writeln(output,'* searches will proceed when pattern is input', ' or with the = command'); end else begin writeln(result,'* searches will proceed only when = is input'); writeln(output,'* searches will proceed only when = is input'); end end; procedure acomment; (* the rest of the input buffer is a commment. the entire line must be written to the result, and perhaps the searchinst files *) begin (* acomment *) (* send it to result file *) write(result,'* '); writestring(result,buffer); writeln(result); if printinginstructions then begin (* send it to the searchinst file *) write(searchinst,'(* '); writestring(searchinst,buffer); writeln(searchinst,' *)') end; (* remove the rest of the line *) clearstring(buffer) end; (* acomment *) (******************************************************************************) (******************************************************************************) (* Routines for handline features *) procedure setfeaturename; (* set the feature name: define the feature and prepare for writing to file searchfeatures. *) var i: integer; (* location in a string *) begin if not dosearchfeatures then begin rewrite(searchfeatures); writeln(searchfeatures,'* search ',version:4:2); dosearchfeatures := true; end; featuredefwritten := false; with thedefinition^ do begin (* transfer the string from pattern *) (* remove final quote (if there is one): *) if pattern.letters[pattern.length] = '"' then pattern.length := pattern.length-1; for i := 2 to pattern.length do nametag.letters[i-1] := pattern.letters[i]; nametag.length := pattern.length -1; (* tell the user about this *) if nametag.length > 0 then begin {write(output,'feature: "'); bug 2006 May 09} write(output,'feature: "'); writequotestring(output,nametag); {write(output,'" will be written to searchfeatures'); bug 2006 May 09} write(output,' will be written to searchfeatures'); if doarrow then writeln(output,' as an arrow.'); writeln(output); write(result,'* feature: '); {bug 2006 May 09} writequotestring(result,nametag); write(result,' will be written to searchfeatures'); {bug 2006 May 09} if doarrow then writeln(result,' as an arrow.'); writeln(result); end else begin writeln(output,'No more features will be written to searchfeatures'); writeln(result,'* No more features will be written to searchfeatures'); end; if doarrow then begin background.letters[1] := '-'; background.length := 1; negparts.length := 2; negparts.letters[1] := '<'; negparts.letters[2] := ']'; posparts.length := 2; posparts.letters[1] := '['; posparts.letters[2] := '>'; doarrow := false (* reset *) {zzzaaa} {zzzfff} end else begin background.letters[1] := '-'; background.length := 1; negparts.length := 2; negparts.letters[1] := '['; negparts.letters[2] := ']'; posparts.length := 2; posparts.letters[1] := '['; posparts.letters[2] := ']'; {zzzNNN} end; locations[1] := 0; locations[2] := 1; marks := 2; min := 0.0; {zzz?} max := 0.0; {zzz?} number := 1; (*[[*) matrix := nil; { Ribound := 0; Zbound := 0; Pbound := 0; } (*]]*) next := nil; end; { } {zzzaaa} writeln(searchfeatures); writeln(searchfeatures,'* THE CURRENT FEATURE DEFINITION IS:'); write(searchfeatures,'* '); writeadefinition(searchfeatures, thedefinition); writeln(searchfeatures); (* 2004 Jul 18: I THINK this is a good place to clear the feature! *) { clearfeature(thefeature); } with thefeature^ do begin with id do begin letters[1] := '!'; length := 1; end; { This is handled in clearfeature: coordinate := 0.0; orientation := +1; } thefeature^.nametag := thedefinition^.nametag; { This is handled in clearfeature: with othertag do begin letters[1] := '?'; length := 0; end; } definition := thedefinition; { This is handled in clearfeature: (*[[*) Ri := 0.0; Z := 0.0; probability := 0.0; (*]]*) unsatisfied := true; fromrange := 0.0; torange := 0.0; number := 1; desiredline := 1; next := nil; } number := 1; desiredline := 1; end; { writeln(searchfeatures); write(searchfeatures,'* INITIAL FEATURE: '); write(searchfeatures,'* '); writeafeature(searchfeatures,thefeature); writeln(searchfeatures); } featureinserts := false; (* inserts to the feature not defined yet *) {zzzfff} end; procedure setarrowfeature; (* reset the feature to be an arrow *) begin doarrow := not doarrow; {zzzaaa} { if doarrow then writeln(output,'Doing arrows for features') else writeln(output,'Doing rectangles for features') } end; (******************************************************************************) (******************************************************************************) procedure writeDelilainst; (* a search subsystem for creating Delila instructions based on search results. see Delilahelp. *) var copy: text; (* internal file for showing searchinst *) begin (* writeDelilainst *) writeln(output,'Entering Delila sub system'); if not printinginstructions then begin (* if we were not printing instructions, then we must make sure that instructions printed from this point have the org, chr or pie information. We force it by resetting the variables. *) {hhh} orgchange := true; chrchange := true; piechange := true; instheader; writeln(output,'Any previous instructions were destroyed.'); writeln(output,'A title has been provided.'); writeln(output,'Defaults have been set.'); end else begin writeln(output,'The searchinst file is not empty.'); writeln(output,'use the show command to see them and'); writeln(output,'use the kill command to restart them'); end; printinginstructions:=true; writeln(output,'Delila instruction printing', ' has been automatically turned ON.'); writeln(output,'from place is ', fromplace:1); writeln(output,' to place is ', toplace:1); repeat answers := 0; repeat if nostring(buffer) then write('Delila '); getchar(input,buffer,command,gotten); answercheck(answers); until gotten; if not (command in ['q','p','f','t','w','s','k','h','i','*']) then begin flagstring(output, buffer); answers := 0; repeat if nostring(buffer) then writeln(output,'do you need help? (y/n)'); getchar(input,buffer,command,gotten); answercheck(answers); until gotten; if command<>'n' then Delilahelp(output) end else if command='h' then Delilahelp(output) else if command='i' then begin answers := 0; repeat if nostring(buffer) then writeln(output,'instruction type was ', insttype:1,', type new:'); getinteger(input,buffer,insttype,gotten); if gotten then if ((insttype<1) and (insttype>3)) then writeln(output,' instruction type must be', ' 1, 2 or 3 '); answercheck(answers); until gotten and ((insttype=1) or (insttype=2) or (insttype=3)); writeln(result,'* instruction type: ',insttype:1); end else if command='p' then begin printinginstructions:=not printinginstructions; write(output,'now'); if not printinginstructions then write(output,' NOT'); writeln(output,' printing Delila instructions'); write(result,'* now'); if not printinginstructions then write(result,' NOT'); writeln(result,' printing Delila instructions') end else if command='f' then begin answers := 0; repeat if nostring(buffer) then writeln(output,'from place was ', fromplace:1,', type new:'); getinteger(input,buffer,fromplace,gotten); answercheck(answers); until gotten; writeln(result,'* bases from: ',fromplace:1); end else if command='t' then begin answers := 0; repeat if nostring(buffer) then writeln(output,'to place was ', toplace:1,', type new:'); getinteger(input,buffer,toplace,gotten); answercheck(answers); until gotten; writeln(result,'* bases to: ',toplace:1); end else if command='w' then begin writeln(output,'write Delila instructions (q to quit):'); repeat readstring(input, buffer); (* pick up a fresh line *) command := buffer.letters[1]; if command<>'q' then begin writestring(searchinst,buffer); writeln(searchinst); write(result,'* '); writestring(result,buffer); writeln(result) end until command='q'; gettoken(input,buffer,pattern,gotten); (* that gets us past the 'quit', pattern is not used so we are safe, and the user may type commands after the quit *) command:='w' (* prevent falling out of Delila *) end else if command='s' then begin writeln(output,'current Delila instructions:'); writeln(result,'* current Delila commands:'); reset(searchinst); rewrite(copy); copyfile(searchinst,copy,false); (* get back searchinst: *) rewrite(searchinst); reset(copy); copyfile(copy,searchinst,false); (* show copy: *) reset(copy); copyfile(copy,output,false); reset(copy); copyfile(copy,result,true); command:='s'; (* prevent falling out *) end else if command='k' then begin answers := 0; repeat if nostring(buffer) then writeln(output,'shall I kill all Delila instructions?'); getchar(input,buffer,command,gotten); answercheck(answers); until gotten; if command='y' then begin instheader; writeln(result,'* all previous Delila instructions killed'); writeln(output,'aaaARRRRGGgg!!') end else writeln(output,'Scardy Cat!') end else if command='*' then acomment; if command = 'q' then begin if fromplace > toplace then flip := true else flip := false end until command='q'; command:='d'; (* prevent falling out of search *) write(output,'Delila instruction printing is '); if printinginstructions then writeln(output,'ON') else writeln(output,'OFF') end; (* writeDelilainst *) procedure setstartshift; (* set the search startpoint and shift between search positions *) begin (* setstartshift *) answers := 0; repeat if nostring(buffer) then writeln(output,'start point was ',startpoint:1, ' type a new one:'); getinteger(input,buffer,startpoint,gotten); if gotten then if startpoint <= 0 then begin writeln(output,'give a positive integer'); gotten := false end; answercheck(answers); until gotten; answers := 0; repeat if nostring(buffer) then writeln(output,'shift was ',shift:1, ' type a new one:'); getinteger(input,buffer,shift,gotten); if gotten then if shift <= 0 then begin writeln(output,'give a positive integer'); gotten := false end; answercheck(answers); until gotten; writeln(result,'* start (phase): ',startpoint:1, ' shift: ',shift:1) end; (* setstartshift *) procedure viewvariables; (* set the characteristics one wants to see *) var ch: char; (* user typed command character *) begin (* view *) answers := 0; repeat if nostring(buffer) then writeln(output,'view (type h for help)'); getchar(input,buffer,ch,gotten); if gotten then gotten := (ch in ['t','e','i','f','s','p','d','m','b','h','n','a','q']); answercheck(answers); until gotten; if ch = 'h' then viewhelp(output) else if ch = 'a' then begin viewt := true; viewe := true; viewi := true; viewf := true; views := true; viewp := true; viewd := true; viewm := true; viewb := true; end else if ch = 'n' then begin viewt := false; viewe := false; viewi := false; viewf := false; views := false; viewp := false; viewd := false; viewm := false; viewb := false; end else case ch of 't': viewt := not viewt; 'e': viewe := not viewe; 'i': viewi := not viewi; 'f': viewf := not viewf; 's': views := not views; 'p': viewp := not viewp; 'd': viewd := not viewd; 'm': viewm := not viewm; 'b': viewb := not viewb; 'q': ; end; viewnothing := not (viewt or viewe or viewi or viewf or views or viewp or viewd or viewm or viewb) end; (* view *) begin (* search *) rewrite(result); (* get the date *) getdatetime(datetime); write(output,'* '); writedatetime(output,datetime); writeln(output,' search ',version:4:2); write(result,'* '); writedatetime(result,datetime); writeln(result,' search ',version:4:2); brinit(book, theline); reset(book); copyaline(book,output); reset(book); copyaline(book,result); (* don't touch the instructions until Delila subsystem starts!!! instheader; *) clearstring(pattern); clearstring(lastpattern); (* defaults for user settable variables *) viewt := true; viewe := true; viewi := true; viewf := true; views := true; viewp := true; viewd := true; viewm := true; viewb := true; viewnothing:=false; mismatches:=0; oktosearch := true; startpoint := 1; shift := 1; printinginstructions:=false; fromplace:=-100; toplace:=+100; insttype:=1; firstinput := true; dosearchfeatures := false; featuredefwritten := false; flip := false; patterncomplement := false; (* ooo *) org.hea.keynam.length := 0; chr.hea.keynam.length := 0; pie := nil; {OOO} orgopen:=false; chropen:=false; pieopen:=false; orgchange:=true; chrchange:=true; piechange:=true; sorgopen:=false; schropen:=false; spieopen:=false; sorgchange:=true; schrchange:=true; spiechange:=true; theline:=0; (* initialize feature names *) new(thefeature); new(thedefinition); clearfeature(thefeature); reusethepiece := false; clearstring(buffer); writeln(output,' NOTE: Your first typed line will be ignored.'); repeat answers := 0; repeat if firstinput then begin write(output,'(type a carriage return now.', ' Your next line will be listened to.)'); firstinput := false; reset(input); end else if nostring(buffer) then write(output,'search '); gettoken(input, buffer, pattern, gotten); answercheck(answers); until gotten; command := pattern.letters[1]; if command='D' then writeDelilainst {ppp} else if command='C' then getcolorbackground else if command='H' then searchhelp(output) else if command='?' then searchhelp(output) else if command='L' then showletters(output) else if command='M' then getmismatches else if command='N' then toggleoktosearch else if command='P' then setstartshift else if command='Q' then writeln(output,'quit') else if command='q' then writeln(output,'quit') else if command='V' then viewvariables else if command='"' then setfeaturename else if command='A' then setarrowfeature {zzzaaa} else if command='*' then acomment else if viewnothing then begin flagstring(output,buffer); writeln(output); writeln(output,' your search command was ignored because'); writeln(output,' no results would be displayed.'); writeln(output,' use the view command to turn displays on.'); end else if command='~' then begin if lastpattern.length <> 0 then begin stringcomplement(lastpattern); patterncomplement := not patterncomplement; if patterncomplement then writeln(output,'now complement to typed pattern') else writeln(output,'now homologous to typed pattern') end else writeln(output,'no previous pattern') end else if command='R' then begin if lastpattern.length <> 0 then begin stringreverse(lastpattern); {qqq} end else writeln(output,'no previous pattern') end else if command='I' then begin if lastpattern.length <> 0 then begin stringinvert(lastpattern); {qqq} end else writeln(output,'no previous pattern') end else if command='=' then begin if lastpattern.length <> 0 then begin analysepattern(lastpattern, exppattern, ok); if ok then multimatch(exppattern,book,mismatches, org, chr, pie, orgchange, chrchange, piechange, orgopen, chropen, pieopen, sorgchange, schrchange, spiechange, sorgopen, schropen, spieopen, patterncomplement) end else writeln(output,'no previous pattern') (* these are the other allowed first letters. note that some commands above exclude their use *) end else if not ( (command in [ '(', '0','1','2','3','4','5','6','7','8','9', 'a','c','g','t', 'm','r','s','v','w','y','h','k','d','b','n','e' ]) or (command='#') or (command='%') or (command='<') or (command='>') or (command='|') or (command='^') or (command='[') or (command=']') ) then begin flagstring(output, buffer); answers := 0; repeat if nostring(buffer) then writeln(output,'do you need help? (y/n)'); getchar(input,buffer,command,gotten); answercheck(answers); until gotten; if command<>'n' then searchhelp(output); command := ' '; (* this prevents the program from stopping if the answer was 'q' *) end else begin analysepattern(pattern,exppattern,ok); if ok then begin patterncomplement := false; (* reset at type in *) lastpattern := pattern; if oktosearch then multimatch(exppattern,book,mismatches, org, chr, pie, orgchange, chrchange, piechange, orgopen, chropen, pieopen, sorgchange, schrchange, spiechange, sorgopen, schropen, spieopen, patterncomplement) end; end until command='q'; 1: end. (* search *)