program sebo(inst, book, target, sebop, instout, list, output); (* sebo: search for aligned book sequences in another book Dr. Thomas D. Schneider National Institutes of Health National Cancer Institute Center for Cancer Research Nanobiology Program Molecular Information Theory Group Frederick, Maryland 21702-1201 toms@ncifcrf.gov permanent email: toms@alum.mit.edu (use only if first address fails) http://www.ccrnp.ncifcrf.gov/~toms/ module libraries: delmod *) label 1; (* end of program *) const (* begin module version *) version = 1.46; (* of sebo.p 2009 Mar 03 2009 Mar 03: 1.46: correct bug from Blake 2008 Jan 16: 1.45: add space before 'times in the target' 2006 Oct 26: 1.44: correct reading params 2006 Oct 26: 1.43: implement rangecontrol 2006 Oct 26: 1.42: allow output instructions to match original fragment 2004 Sep 9: 1.41: upgrade for GPC 2004 Apr 30: 1.40: spelling correction, guarantee 2003 Aug 25: 1.39: bug: output at every base for book alignment 2002 Aug 27: 1.38: Do not halt if probe is larger than target sequence 2001 May 7: 1.37: report total number of probes found. 2001 Mar 26: 1.34: note in bugs on shift parameter 2001 Mar 23: 1.33: count targets and probes 2001 Mar 23: 1.32: clean up after memory leak solved. 2001 Mar 23: 1.31: hunt for a memory leak 2000 Nov 8: 1.25: upgrade documentation and fix writeinstructions bflip 2000 jun 27: 1.20: names of instout default to previous names 2000 jun 27: 1.18: add examples 2000 jun 27: 1.17: fully functional 2000 jun 26: 1.14: alert parameter 2000 jun 26: 1.12: allow mismatches 2000 jun 26: 1.11: fully functional: found that Ecoli ahpC is next to dsbG! 2000 jun 26: 1.04: barely functional 2000 jun 24: 1.01: reads target and book. 2000 jun 24: 1.00: origin *) updateversion = 1.21; (* defines lowest acceptable current parameter file *) (* end module version *) (* begin module describe.sebo *) (* name sebo: search for aligned book sequences in another book synopsis sebo(inst: in, book: in, target: in, sebop: in, instout: out, list: out, output: out) files inst: Delila instructions to create a book. book: The Delila book created with inst, containing fragments to search in target. target: Target book to search, usually a whole genome. The sequence is treated as a circle to guarantee correct results on circular genomes. The incorrect results on linear chromosomes will be quite rare because of the telomeres. sebop: parameters to control the program. The file must contain the following parameters, one per line: 1. parameterversion: The version number of the program. This allows the user to be warned if an old parameter file is used. 2. If the first character of the second line is 'f' (for 'first') then the sequences are always aligned by their first base. 'i' then the sequences are aligned by the delila instructions. If the inst file is empty, alignment is forced to the 'b' mode. 'b' (for 'internal') then the alignment is on the internal zero of the book's sequence. This option is to be used when "default coordinate zero" is used in the Delila instructions. 3. fromdo, todo: (integer) range of aligned book to use in the search. 4. rangecontrol, frominst, toinst: (char, integer, integer): Range of Delila instructions output to instout. If range control, the first character on the line is: 'a' then the instructions will give the ORIGINAL fragment in absolute coordinates. 'r' then the instructions will give the ORIGINAL fragment in relative coordinates. For any other initial character, the instructions will give the range frominst to toinst. 5. mismatches: (integer) number of mismatches allowed. 6. alertinterval: (integer) Many genomes are large and a search may take a while, making the program seem to be doing nothing. To observe that the program is running, set this parameter to a number of bases. Sebo will write out the location it is currently searching every alertinterval bases. Nonpositive values disable the feature. instout: revised inst giving Delila instructions for finding the fragments specified in inst/book in the target. Full names of pieces from the book (such as those assigned by Delila instructions of the form "name 'abinddingsite';") will default to previous full names if there are any. This follows the convention of blank name on the alist being the previous name. list: display of aligned locations found. output: messages to the user description Nowadays it is often the case that old GenBank entries become fused into a single genome. It would be nice to be able to automatically convert old delila instructions to the new genome. examples ******************************************************************************** Example 1 ----- sebo.inst: title "An OxyR site"; {Example instruction file for sebo } { number only the pieces, starting at 1 } default numbering piece; default numbering 1; default out-of-range reduce-range; organism E.coli; chromosome E.coli; name "ahpC"; piece D13187; { ECOD13187 }; get from 116 -200 to 116 +200 direction +; ----- sebop: 1.21 version of sebo that this parameter file is designed for. i f: first base, i: inst, b: book alignment -30 30 fromdo todo: range of aligned book to use in the search. -200 200 frominst toinst: range of delila instructions output to instout 2 number of mismatches allowed 500000 alertinterval (bases) ----- target: E. coli genome U00096 ----- instout: title "sebo 1.21 search with book"; { sebop parameters: i: use the alignedbase from the book -30 30 range of book alignment used for search -200 200 range of resulting output instructions 2 mismatches allowed 500000 alert interval } organism E.coli; chromosome E.coli; piece U00096; { the target sequence is 4639221 bases } { original source probe: } { name ""; piece D13187; get from 1 to 316 direction +; } { final target instructions: } name "ahpC"; get from 638089 -200 to same +200 direction +; ----- list: sebo 1.21 search with book"; sebop parameters: i: use the alignedbase from the book -30 30 range of book alignment used for search -200 200 range of resulting output instructions 2 mismatches allowed 500000 alert interval Target sequence: piece U00096; get from 1 to 4639221 direction +; { 4639221 bases } Searching target with probe: name "ahpC"; piece D13187; get from 1 to 316 direction +; --------------------- +++++++++++++++++++++ 322222222221111111111--------- +++++++++111111111122222222223 0987654321098765432109876543210123456789012345678901234567890 ttacgaaggttgtaaggtaaaacttatcgatttgataatggaaacgcattaccggaatcgg probe X X differences ttacgaaggttgtaaggtaaaacttatcgatttgataatggaaacgcattagccgaatcgg target ^ found at 638089 on the target ******************************************************************************** Example 2 Suppose that you have some sequences in a file and one would like to locate them on the chromosome of an organism in the form of Delila instructions. Here is how to create the input files for sebo: 1. Convert the sequences into a Delila book using one of the programs rawbk, makebk, dbbk, or mkdb (see the web page mentioned below). This gives you the file 'book' in directory 1. 2. In another directory (2) build a Delila library for your organism (this is also described on that web page). 3. Use delila to extract both the sequence and the complement, for example: title "Delila instructions for Bacteriophage T4 and its complement"; organism c.T4; chromosome c.T4; piece AF158101; get all piece; get all piece direction -; 4. Move or link the resulting book into the file 'target' in Directory 1. 5. Then set up the sebop for searching without Delila instructions (since no delila instructions were used to make the book): 1.21 version of sebo that this parameter file is designed for. f f: first base, i: inst, b: book alignment 0 40 fromdo todo: range of aligned book to use in the search. 0 40 frominst toinst: range of delila instructions output to instout 10 number of mismatches allowed 500000 alertinterval (bases) 6. Finally use sebo to create the instout. You may have to allow for some mismatches. These instructions should allow you to extract the sequences from the organism database 7. Sebo reports its results by adding lots of comments to instout in the form {}. If you want to remove them, (so you have a clean set of instructions) you can use the nocom program. You can remove the extra blanks with noblank. In unix: nocom < instout | sed -e 's/{}//g' | noblank > instclean You can also remove redundant delila instructions for organism, chromosome and piece by hand, especially if there is only one piece in the target. ******************************************************************************** documentation see also {Sequence extraction program:} delila.p {Simple search engine:} search.p {More details on alignment types:} alist.p {example sebop parameter file:} sebop {example inst file:} sebo.inst {Programs for conversion of raw sequences into a Delila Book:} rawbk.p makebk.p dbbk.p mkdb.p {Conversion of a book of sequences into a Delila Library:} http://www.lecb.ncifcrf.gov/~toms/delilalibraries.html {Remove the comments created by sebo:} nocom.p {Remove the blank lines created by sebo:} noblank.p {Shift the instructions to whereever one wants:} instshift.p author Thomas Dana Schneider bugs technical notes * The org/chr/pie names written to delila instructions come from the current target sequence. * Delila instructions for sites frequently come in pairs: get from 163 -200 to 163 +200 direction +; get from 163 +200 to 163 -200 direction -; So the target will be searched in both orientations. * constant dnamax is set to a large value to increase the speed of the search. * a nice parameter to have would allow the user to shift the coordinate of the zero into any position they want in the piece. Fortunately this can be done with the instshift program, so this is not high priority. The base that one specifies would become the zero base of the Delila instructions. * 2001 April 17: if the fromdo/todo range given for the book is outside of the piece in the book (in aligned searching), then the book sequence will not be found in the target. *) (* end module describe.sebo *) (* 2001 Mar 25 * memory leak information: The memory leak can be seen with the SIZE parameter of the top program. The value of SIZE continuously increases as the program runs. Memory leak occurs under gpc and sun compilers. The freedna variable always has 0 links during the loop! The cleardna routine is never called, no halt there. The clearpiece routine IS called, halt there halts. The call to clearpiece is from getocp. Why are no links going onto the freedna list at that point? I have demonstrated that there is indeed a memory leak! By cranking up the size of the dna segments from 5000000 (5e6) to 100000000 (1e8) I got sebo to find a bunch of targets and THEN to crash: Ran out of memory Trace/Breakpoint Trap Since it should reuse the arrays, this should not happen unless the arrays are being wasted (memory is allocated but lost and then the next sequence uses more memory). Also, top shows it going up more rapidly. dnamax = 100000000; { causes crash} Now to find out why it is loosing the dna links and not reusing them. It was rather subtle. I was looking at a routine called getocp (get organism, chromosome, piece) which DOES clear the DNA with each use. To my surprise sebo was not using getocp. But the program can also use alignments, depending on the sebop. Indeed, you had set the sebop to use delila instructions, but had left the inst file EMPTY. This caused the program to use the alignement routines to read the sequences. But that routine does not clear the DNA and so there was an overflow. So I have put a halt in; sebo 1.31 i: use the alignedbase from the book 75 125 range of book alignment used for search -100 100 range of resulting output instructions 2 mismatches allowed 50000 alert interval The sebop requests instructions to be used but the inst file is empty! program halt. However these routines are called: align getpiece brpiece brdna getdna So getdna is probably guilty! Here is the original code: if freedna<>nil then begin IT NEVER REACHES HERE l:=freedna; freedna:=freedna^.next end else new(l); l^.length:=0; l^.next:=nil Fortunately the bug was simple. I used getocp which automatically takes care of memory. But for the align routine, it can't do that and so the sebo program has to. I forgot to clearpiece(Bpie); Adding this solved the problem. *) (* LOCK begin module book.const *) (* constants needed for book manipulations *) { dnamax = 1024; (* length of dna arrays *) } dnamax = 5000000; (* length of dna arrays INCREASE TO GENOME SIZE FOR SPEED *) namelength = 100; (* maximum key name length *) linelength = 80; (* maximum line readable in book *) (* LOCK end module book.const version = 7.49; {of delmod.p 2000 June 26} *) (* begin module string.const *) maxstring = 2000; (* the maximum string *) (* end module string.const version = 4.86; (@ of prgmod.p 2004 Sep 8 *) (* begin module filler.const *) fillermax = 50; (* the size of the filler array for a string *) (* end module filler.const version = 4.86; (@ of prgmod.p 2004 Sep 8 *) type (* begin module string.type *) stringptr = ^string; (* pointer to a string *) string = record (* a string of characters *) letters: array[1..maxstring] of char; (* the letters in the string *) length: integer; (* the number of characters in the string *) current: integer; (* the letter we are working on *) next: stringptr; (* the next string in a series *) end; (* end module string.type version = 4.86; (@ of prgmod.p 2004 Sep 8 *) (* begin module filler.type *) (* the following is an array used to fill a string. it is convenient to have it much shorter than the maxstring, so that it is easy to fill the string using procedure fillstring. the user must declare the value of constant fillermax. *) filler = packed array[1..fillermax] of char; (* end module filler.type version = 4.86; (@ of prgmod.p 2004 Sep 8 *) (* begin module trigger.type *) trigger = record (* an object to be searched for *) seek: string; (* the characters looked for *) state: integer; (* how close to triggering we are *) skip: boolean; (* trigger not found- skip the line *) found: boolean (* the trigger was found *) end; (* end module trigger.type version = 4.86; (@ of prgmod.p 2004 Sep 8 *) (* begin module book.type *) (* types needed for book manipulations *) chset = set of 'a'..'z'; (* types defined in book definition *) alpha = packed array[1..namelength] of char; (* this is not alfa *) (* name is a left justified string with blanks following the characters *) name = record letters: alpha; length: 0..namelength (* zero means an unspecified structure *) end; lineptr = ^line; line = record (* a line of characters *) letters: packed array [1..linelength] of char; length: 0..linelength; next: lineptr end; direction = (plus, minus, dircomplement, dirhomologous); configuration = (linear, circular); state = (on, off); header = record (* header of key *) keynam: name; (* key name of structure *) fulnam: lineptr; (* full name of structure *) note: lineptr (* note key *) end; (* begin module base.type *) (* define the four nucleotide bases *) base = (a,c,g,t); (* end module base.type version = 7.67; {of delmod.p 2004 Sep 8} *) (* sequence types *) dnaptr = ^dnastring; dnarange = 0..dnamax; seq = packed array[1..dnamax] of base; dnastring = record part: seq; length: dnarange; next: dnaptr end; orgkey = record (* organism key *) hea: header; mapunit: lineptr (* genetic map units *) end; chrkey = record (* chromosome key *) hea: header; mapbeg: real; (* number of genetic map beginning *) mapend: real (* number of genetic map ending *) end; pieceptr = ^piece; piekey = record (* piece key *) hea: header; mapbeg: real; (* genetic map beginning *) coocon: configuration; (* configruation (circular/linear) *) coodir: direction; (* direction (+/-) relative to genetic map *) coobeg: integer; (* beginning nucleotide *) cooend: integer; (* ending nucleotide *) piecon: configuration; (* configruation (circular/linear) *) piedir: direction; (* direction (+/-) relative to coordinates *) piebeg: integer; (* beginning nucleotide *) pieend: integer; (* ending nucleotide *) end; piece = record key: piekey; dna: dnaptr end; reference = record pienam : name; (* name of piece referred to *) mapbeg : real; (* genetic map beginning *) refdir : direction; (* direction relative to coordinates *) refbeg : integer; (* beginning nucleotide *) refend : integer; (* ending nucleotide *) end; genkey = record (* gene key *) hea : header; ref : reference; end; trakey = record (* transcript key *) hea : header; ref : reference; end; markerptr = ^marker; markey = record (* marker key *) hea : header; ref : reference; sta : state; phenotype : lineptr; next : markerptr; end; marker = record key : markey; dna : dnaptr; end; (* end module book.type version = 7.67; {of delmod.p 2004 Sep 8} *) var inst, book, (* file used by this program *) target, (* file used by this program *) sebop, (* file used by this program *) list, (* file used by this program *) instout: text; (* file used by this program *) (* begin module book.var *) (* ************************************************************************ *) (* global variables needed for book manipulations *) (* free storage: *) freeline: lineptr; (* unused lines *) freedna: dnaptr; (* unused dnas *) readnumber: boolean; (* whether to read a number from the notes, or to read in the notes *) number: integer; (* the number of the item just read *) numbered: boolean; (* true when the item just read is numbered *) skipunnum: boolean; (* a control variable to allow skipping of un-numbered items in the book *) (* ************************************************************************ *) (* end module book.var version = 7.67; {of delmod.p 2004 Sep 8} *) (* begin module halt *) procedure halt; (* stop the program. the procedure performs a goto to the end of the program. you must have a label: label 1; declared, and also the end of the program must have this label: 1: end. examples are in the module libraries. this is the only goto in the delila system. *) begin writeln(output,' program halt.'); goto 1 end; (* end module halt version = 7.67; {of delmod.p 2004 Sep 8} *) (* begin module copyaline *) procedure copyaline(var fin, fout: text); (* copy a line from file fin to file fout *) begin (* copyaline *) while not eoln(fin) do begin fout^ := fin^; put(fout); get(fin) end; readln(fin); writeln(fout); end; (* copyaline *) (* end module copyaline version = 7.67; {of delmod.p 2004 Sep 8} *) (******************************************************************************) (******************************************************************************) (******************************************************************************) (* begin module package.trigger *) (* ************************************************************************ *) (* begin module clearstring *) procedure clearstring(var ribbon: string); (* empty the string *) var index: integer; (* to the ribbon *) begin (* clearstring *) with ribbon do begin for index := 1 to maxstring do letters[index] := ' '; length := 0; current := 0; end end; (* clearstring *) procedure initializestring(var ribbon: string); (* start the string with a nil pointer. This routine should be called before doing linked list work. This allows the standard string routines to clear the string without killing the pointer. *) begin (* initializestring *) clearstring(ribbon); ribbon.next := nil; end; (* initializestring *) (* end module clearstring version = 4.86; (@ of prgmod.p 2004 Sep 8 *) (* begin module writestring *) procedure writestring(var tofile: text; var s: string); (* write the string s to file tofile, no writeln *) var i: integer; (* index to s *) begin (* writestring *) with s do for i := 1 to length do write(tofile, letters[i]) end; (* writestring *) (* end module writestring version = 4.86; (@ of prgmod.p 2004 Sep 8 *) (* begin module filler.fillstring *) procedure fillstring(var s: string; a: filler); (* this procedure makes it reasonably easy to fill the string s with characters. one calls the procedure as: *) (* 1 2 3 4 5 *) (* 12345678901234567890123456789012345678901234567890 *) (* fillstring(s, 'this-is-the-string '); the two comments make it easy to line the characters up. also, for this example, it was assumed that the length of filler as defined by the constant fillermax was 50. *) var length: integer; (* of the string without trailing blanks *) index: integer; (* of s *) begin (* fillstring *) clearstring(s); length := fillermax; while (length > 1) and (a[length] = ' ') do length := pred(length); if (length = 1) and (a[length] = ' ') then begin writeln(output, 'fillstring: the string is empty'); halt end; for index := 1 to length do s.letters[index] := a[index]; s.length := length; s.current := 1 end; (* fillstring *) (* end module filler.fillstring version = 4.86; (@ of prgmod.p 2004 Sep 8 *) (* begin module filler.filltrigger *) procedure filltrigger(var t: trigger; a: filler); (* fill the trigger t *) begin (* filltrigger *) fillstring(t.seek,a) end; (* fillstring *) (* end module filler.filltrigger version = 4.86; (@ of prgmod.p 2004 Sep 8 *) (* begin module trigger.proc *) (* this module allows one to scan a series of characters, as from an array or a file, and to "trigger" or detect a simple string in the series. the advantage of the trigger is that several triggers can "observe" a stream of characters at once, each looking for a different thing. some other modules required: interact.const, interact.type *) procedure resettrigger(var t: trigger); (* reset the trigger to ground state *) begin (* resettrigger *) with t do begin state := 0; skip := false; found := false end end; (* resettrigger *) procedure testfortrigger(ch: char; var t: trigger); (* look at the character ch. if it is part of the trigger (at the current trigger state), then the trigger state goes higher. if it is not part of the trigger then the trigger state is reset, skip is true and one should skip onward to find the trigger. if the trigger is found, found is true. 1996 Sep 12: Bug found! In the case of a trigger "ab", the program used to miss it for situations like "aab". This was because at the first a it would step up. Then it would see the second a and recognize that was not part of ab. It would fail to realize that it could be the start of a new one. The code now accounts for that possibility. *) begin (* testfortrigger *) with t do begin state := succ(state); { writestring(list,seek); writeln(list,'testfortrigger seek.letters[',state:1,']:', seek.letters[state],' ch:',ch); } if seek.letters[state] = ch then begin skip := false; if state = seek.length then found := true else found := false end else begin (* it failed. But wait! It could be the beginning of a NEW trigger string! *) if seek.letters[1] = ch then begin state := 1; skip := false; found := false end else begin (* reset trigger *) state := 0; skip := true; found := false end end end end; (* testfortrigger *) (* end module trigger.proc version = 4.86; (@ of prgmod.p 2004 Sep 8 *) (* begin module skipblanks *) (* 2003 July 31: tab is considered a blank character *) function isblank(c: char): boolean; (* is the character c blank or tab? *) begin isblank := (c = ' ') or (c = chr(9)) end; procedure skipblanks(var thefile: text); (* skip over blanks until a non-blank, or end of line, is found *) begin while isblank(thefile^) and not eoln(thefile) do get(thefile); end; procedure skipnonblanks(var thefile: text); (* skip over nonblanks until a blank, or end of line, is found *) begin while (not isblank(thefile^)) and not eoln(thefile) do get(thefile); end; procedure skipcolumn(var thefile: text); (* skip over a data column *) begin skipblanks(thefile); skipnonblanks(thefile) end; (* end module skipblanks version = 4.86; (@ of prgmod.p 2004 Sep 8 *) (* ************************************************************************ *) (* end module package.trigger version = 4.86; (@ of prgmod.p 2004 Sep 8 *) (******************************************************************************) (******************************************************************************) (******************************************************************************) (* begin module package.align *) (* ************************************************************************ *) (* begin module package.getpiece *) (* ************************************************************************ *) (* begin module package.brpiece *) (* ************************************************************************ *) (* begin module book.basis *) (* procedures needed for book manipulations *) (* get procedures should be used for all linked lists of records *) procedure getline(var l: lineptr); (* obtain a line from the free line list or by making a new one *) begin if freeline<>nil then begin l:=freeline; freeline:=freeline^.next end else new(l); l^.length:=0; l^.next:=nil end; procedure getdna(var l: dnaptr); begin if freedna<>nil then begin l:=freedna; freedna:=freedna^.next end else new(l); l^.length:=0; l^.next:=nil end; (* clear procedures should be called each time the records are no longer needed failure to do this may result in a stack overflow. *) procedure clearline(var l: lineptr); (* return a line to the free line list *) var lptr: lineptr; begin if l<>nil then begin lptr:=l; l:=l^.next; lptr^.next:=freeline; freeline:=lptr end end; procedure writeline(var afile: text; l: lineptr; carriagereturn: boolean); (* write a line to a file, with carriage return if carriagereturn is true. *) var index: integer; (* index to characters in l *) begin with l^ do begin for index := 1 to length do write(afile, letters[index]); end; if carriagereturn then writeln(afile); end; procedure showfreedna; (* show the freedna list *) var counter: integer; (* count of freedna list *) l: dnaptr; (* pointer into freedna list *) begin l := freedna; counter := 0; while l <> nil do begin counter := succ(counter); write(output,counter:1); write(output, ', length = ',l^.length:1); { This is illegal according to gpc because one cannot write a pointer to a text file. It can be unearthed for debugging. write(output, ', pointer id: ',l:1); } writeln(output); l := l^.next end; end; procedure cleardna(var l: dnaptr); (* clear the dna strutures to the free list *) var lptr: dnaptr; begin if l<>nil then begin lptr:=l; l:=l^.next; lptr^.next:=freedna; freedna:=lptr end end; procedure clearheader(var h: header); (* clear the header h (remove lines to free storage) *) begin with h do begin clearline(fulnam); while note<>nil do clearline(note) end end; procedure clearpiece(var p: pieceptr); (* clear the dna of the piece *) begin while p^.dna<>nil do cleardna(p^.dna); clearheader(p^.key.hea) end; function chartobase(ch:char):base; (* convert a character into a base *) begin case ch of 'a': chartobase:=a; 'c': chartobase:=c; 'g': chartobase:=g; 't': chartobase:=t end end; function basetochar(ba:base):char; (* convert a base into a character *) begin case ba of a: basetochar:='a'; c: basetochar:='c'; g: basetochar:='g'; t: basetochar:='t'; end end; function complement(ba:base):base; (* take the complement of ba *) begin case ba of a: complement:=t; c: complement:=g; g: complement:=c; t: complement:=a; end end; function chomplement(b: char): char; (* create the character complement of base b. I must be getting hungry! *) begin chomplement := basetochar(complement(chartobase(b))); end; function pietoint(p: integer; pie: pieceptr): integer; (* p is a coordinate on the piece. we want to transform p into a number from 1 to n: an internal coordinate system for easy manipulation of piece coordinates *) (* Note: the dirhomologous and dircomplement are treated as plus and minus directions, which MIGHT NOT BE RIGHT! *) var i: integer; (* an intermediate value *) begin with pie^.key do begin case piedir of dirhomologous, plus: if p>=piebeg then i:=p-piebeg+1 else i:=(p-coobeg)+(cooend-piebeg)+2; dircomplement, minus: if p<=piebeg then i:=piebeg-p+1 else i:=(cooend-p)+(piebeg-coobeg)+2 end; pietoint:=i end end; function inttopie(i: integer; pie: pieceptr):integer; (* i is in the range 1 to some maximum. it is an internal coordinate system for the program. we want to do a coordinate transformation to obtain a value in the range of the piece called pie: i=1 corresponds to piebeg and i=its maximum corresponds to pieend *) (* Note: the dirhomologous and dircomplement are treated as plus and minus directions, which MIGHT NOT BE RIGHT! *) var p: integer; (* an intermediate value *) begin with pie^.key do begin case piedir of dirhomologous, plus: begin p:=piebeg+(i-1); if p>cooend then if coocon=circular then p:=p-(cooend-coobeg+1) end; dircomplement, minus: begin p:=piebeg-(i-1); if p '*' then begin writeln(output,' procedure skipstar: bad book'); writeln(output,' "*" expected as first character on the line, but "', thefile^,'" was found'); halt end; get(thefile); (* skip the star *) if thefile^ <> ' ' then begin writeln(output,' procedure skipstar: bad book'); writeln(output,' "* " expected on a line but "*', thefile^,'" was found'); halt end; get(thefile) (* skip the blank *) end end; (* skipstar *) (* end module book.skipstar version = 7.67; {of delmod.p 2004 Sep 8} *) (* begin module book.brreanum *) procedure brreanum(var thefile: text; var theline: integer; var reanum: real); (* read a real number from the file *) begin skipstar(thefile); readln(thefile,reanum); theline := succ(theline) end; (* end module book.brreanum version = 7.67; {of delmod.p 2004 Sep 8} *) (* begin module book.brnumber *) procedure brnumber(var thefile: text; var theline: integer; var num: integer); (* read a number from the file *) begin skipstar(thefile); readln(thefile,num); theline := succ(theline) end; (* end module book.brnumber version = 7.67; {of delmod.p 2004 Sep 8} *) (* begin module book.brname *) procedure brname(var thefile: text; var theline: integer; var nam: name); (* read a name from the file *) var i: integer; (* an index to the name *) c: char; (* a character read *) begin (* brname *) skipstar(thefile); with nam do begin length:=0; repeat length:=succ(length); read(thefile,c); letters[length] := c until (eoln(thefile)) or (length>=namelength) or (letters[length]=' '); if letters[length]=' ' then length:=length-1; if length 'n' then begin skipstar(thefile); if not eoln(thefile) then begin if thefile^ = '#' then begin numbered := true; get(thefile); (* move past the number symbol *) read(thefile,number); end end; repeat readln(thefile); theline := succ(theline) until thefile^ = 'n'; readln(thefile); theline := succ(theline) end else begin readln(thefile); theline := succ(theline) end end end; (* brnotenumber *) (* end module book.brnotenumber version = 7.67; {of delmod.p 2004 Sep 8} *) (* begin module book.brnote *) procedure brnote(var thefile: text; var theline: integer; var note: lineptr); (* read note key *) var newnote: lineptr; (* the new note *) previousnote: lineptr; (* the last line of the notes *) begin (* brnote *) note:=nil; if thefile^ = 'n' then begin (* enter note *) readln(thefile); theline := succ(theline); if thefile^ <> 'n' then begin (* abort null note (n/n) *) getline(note); newnote:=note; while thefile^ <> 'n' do begin (* wait until end of note *) brline(thefile,theline,newnote); previousnote:=newnote; (* get next note *) getline(newnote^.next); newnote:=newnote^.next; end; (* last note was not used, so: *) clearline(newnote); previousnote^.next:=nil; readln(thefile); theline := succ(theline); end else begin readln(thefile); theline := succ(theline); end; end end; (* brnote *) (* end module book.brnote version = 7.67; {of delmod.p 2004 Sep 8} *) (* begin module book.brheader *) procedure brheader(var thefile: text; var theline: integer; var hea: header); (* read the header of a key. *) begin with hea do begin readln(thefile); (* move past the object name - new definition 1999 Mar 13 *) theline := succ(theline); {bbb} (* read key name *) brname(thefile,theline,keynam); (* read full name *) getline(fulnam); brline(thefile,theline,fulnam); (* read note key *) if readnumber then brnotenumber(thefile,theline,note) else brnote(thefile,theline,note) end end; (* end module book.brheader version = 7.67; {of delmod.p 2004 Sep 8} *) (* begin module book.copyheader *) procedure copyheader(fromhea: header; var tohea: header); (* copy the header fromhea into tohea. Note that the linked objects are NOT copied, but merely pointed to. *) begin tohea.keynam.letters := fromhea.keynam.letters; tohea.keynam.length := fromhea.keynam.length; tohea.note := fromhea.note; tohea.fulnam := fromhea.fulnam; end; (* end module book.copyheader version = 7.67; {of delmod.p 2004 Sep 8} *) (* begin module book.brpiekey *) procedure brpiekey(var thefile: text; var theline: integer; var pie: piekey); (* read piece key, track the line number *) begin with pie do begin brheader(thefile,theline,hea); brreanum(thefile,theline,mapbeg); brconfig(thefile,theline,coocon); brdirect(thefile,theline,coodir); brnumber(thefile,theline,coobeg); brnumber(thefile,theline,cooend); brconfig(thefile,theline,piecon); brdirect(thefile,theline,piedir); brnumber(thefile,theline,piebeg); brnumber(thefile,theline,pieend); end end; (* end module book.brpiekey version = 7.67; {of delmod.p 2004 Sep 8} *) (* begin module book.brdna *) procedure brdna(var thefile: text; var theline: integer; var dna: dnaptr); (* read in dna from thefile, track the line *) (* note: if the dna were circularized, by linking the last dnastring to the first, then the cleardna routine could not clear properly, and would loop forever... there is no reason to do that, since a simple mod function will allow one to access the circle. *) var ch: char; workdna: dnaptr; begin getdna(dna); workdna:=dna; ch:=getto(thefile,theline,['d']); readln(thefile); theline := succ(theline); read(thefile,ch); (* skipstar *) while (ch = '*') do begin read(thefile,ch); (* skip blank *) repeat read(thefile,ch); if ch in ['a','c','g','t'] then begin if workdna^.length=dnamax then begin getdna(workdna^.next); workdna:=workdna^.next end; workdna^.length:=succ(workdna^.length); workdna^.part[workdna^.length]:=chartobase(ch) end until eoln(thefile); readln(thefile); (* go to next line *) theline := succ(theline); read(thefile,ch); (* ch is either '*' or 'd' *) end; readln(thefile); (* read past the d *) theline := succ(theline); end; (* end module book.brdna version = 7.67; {of delmod.p 2004 Sep 8} *) (* begin module book.brpiece *) procedure brpiece(var thefile: text; var theline: integer; var pie: pieceptr); (* read in a piece, change theline to reflect the lines traversed *) begin { readln(thefile); (* move past the word 'piece' - new definition 1999 Mar 13 *) theline := succ(theline); (* BUG: was below! *) bbb} brpiekey(thefile,theline,pie^.key); if numbered or (not skipunnum) then brdna(thefile,theline,pie^.dna); readln(thefile); (* move past the word 'piece' - new definition 1999 Mar 13 *) theline := succ(theline); end; (* end module book.brpiece version = 7.67; {of delmod.p 2004 Sep 8} *) (* begin module book.brinit *) procedure brinit(var book: text; var theline: integer); (* check that the book is ok to read, and set up the global variables for br routines *) begin (* brinit *) (* halt if the book is bad (first word is 'halt') or the first character is not * *) reset(book); if not eof(book) then begin (* check for the date line *) if book^ <> '*' then begin if book^ <> 'h' then writeln(output, ' this is not the first line of a book:') else writeln(output, ' bad book:'); write(output, ' '); while not (eoln(book) or eof(book)) do begin write(output, book^); get(book) end; writeln(output); halt end end else begin writeln(output, ' book is empty'); halt end; (* initialize free storage *) freeline:=nil; freedna:=nil; readnumber:=true; (* usually we read in numbers for items *) number:=0; (* arbitrary value *) numbered:=false; (* the piece has no number (none yet read in) *) skipunnum:=false; theline := 1; end; (* brinit *) (* end module book.brinit version = 7.67; {of delmod.p 2004 Sep 8} *) (* ************************************************************************ *) (* end module package.brpiece version = 7.67; {of delmod.p 2004 Sep 8} *) (* begin module book.getpiece *) procedure getpiece(var thefile: text; var theline: integer; var pie: pieceptr); (* move to and read in the next piece in the book *) var ch: char; begin ch:=getto(thefile,theline,['p']); (* get to the next p(iece) in the book *) if ch<>' ' then begin brpiece(thefile,theline,pie); { 1999 june 2: removed this: ch:=getto(thefile,theline,['p']); (* read to end of p *) } { bbb - now done in brpiece readln(thefile); (* read past piece *) theline := succ(theline); } end else clearpiece(pie); end; (* end module book.getpiece version = 7.67; {of delmod.p 2004 Sep 8} *) (* ************************************************************************ *) (* end module package.getpiece version = 7.67; {of delmod.p 2004 Sep 8} *) (* begin module findblank *) procedure findblank(var afile: text); (* read a file to find the next blank character *) var ch: char; begin repeat read(afile,ch) until ch = ' ' end; (* end module findblank version = 7.67; {of delmod.p 2004 Sep 8} *) (* begin module findnonblank *) procedure findnonblank(var afile: text; var ch: char); (* find the next non blank character in a file, return it in ch. *) begin ch:=' '; while (not eof(afile)) and (ch = ' ') do begin read(afile,ch); if eoln(afile) then readln(afile) end end; (* end module findnonblank version = 7.67; {of delmod.p 2004 Sep 8} *) (* begin module align.align *) procedure align(var inst, book: text; var theline: integer; var pie: pieceptr; var length, alignedbase: integer); (* documentation on align is in module info.align and delman.use.aligned.books. 1996 Sep 12: The routine now uses the trigger functions found in prgmod. The bug in the oldalign routine (that it misses the end of comments that end in a series of astrisks) has been fixed. It now checks that the piece corresponds to the book. *) const maximumrange = 10000; (* if the alignment point is more than this distance from the piece ends, the program halts in an attempt to catch the alignment bug... 1991 Jan 11 It appears that the rewrite of the code has removed the bug, but the check will be kept. *) semicolon = ';'; (* end of delila instruction *) var ch: char; (* a character in inst *) p: integer; (* index to a piece name *) p1: integer; (* another index to a piece name *) done: boolean; (* done finding an aligning get *) thebase: integer; (* the base read in *) indefault: boolean; (* true when within a default statement. These can contain the word 'piece', which must be ignored. *) gettrigger: trigger; (* trigger to find 'get' *) defaulttrigger: trigger; (* trigger to find 'default' *) nametrigger: trigger; (* trigger to find 'name' *) piecetrigger: trigger; (* trigger to find 'piece' *) settrigger: trigger; (* trigger to find 'set' *) begincomment: trigger; (* trigger to find '(-*' (ignore the dash!) *) endcomment: trigger; (* trigger to find '*-)' (ignore the dash!) *) begincurly: trigger; (* trigger to find comments: '{' *) endcurly: trigger; (* trigger to find comments: '}' *) quote1trigger: trigger; (* trigger to find single quote ' *) quote2trigger: trigger; (* trigger to find double quote " *) { procedure rd(var f: text; var ch: char); (* read ch from f allowing inspection of the result *) begin read(f,ch); write(output,ch); write(list,ch); write(output,'<',ch,'>'); end; procedure rdln(var f: text); (* readln f allowing inspection of the result *) begin readln(f); writeln(output); writeln(list); end; } procedure skipcomment(var f: text); (* skip an entire comment *) var comment: boolean; (* true means we are inside a comment *) begin (* skip to end of comment *) resettrigger(endcomment); comment := true; while comment do begin if eof(f) then begin writeln(output,'A comment does not end!'); halt end; if eoln(f) then readln(f) { rdln(f) } else begin {write(output,'<'); rd(f,ch); write(output,'>');} read(f,ch); testfortrigger(ch, endcomment); if endcomment.found then comment := false; end end end; procedure skipcurly(var f: text); (* skip an entire comment made by {}*) var comment: boolean; (* true means we are inside a comment *) begin (* skip to end of comment *) resettrigger(endcurly); comment := true; while comment do begin if eof(f) then begin writeln(output,'A comment does not end!'); halt end; if eoln(f) then readln(f) { rdln(f) } else begin {write(output,'<'); rd(f,ch); write(output,'>');} read(f,ch); testfortrigger(ch, endcurly); if endcurly.found then comment := false; end end end; procedure skipquote(quote: trigger); (* skip an entire quote of either the ' or " persuasion *) var kind: char; (* the kind of quote, ' or " *) begin kind := quote.seek.letters[1]; {writeln(output,'skipquote ',kind);} repeat findnonblank(inst,ch); (* get to the quote *) until (ch = kind) or eof(inst); if ch <> kind then begin writeln(output,'end of quote starting with ',kind,' not found'); halt; end; end; begin filltrigger(defaulttrigger,'default'); filltrigger(gettrigger,'get '); filltrigger(nametrigger,'name '); filltrigger(piecetrigger,'piece '); filltrigger(settrigger,'set '); filltrigger(begincomment,'(* '); filltrigger(endcomment,'*) '); filltrigger(begincurly,'{ '); filltrigger(endcurly,'} '); filltrigger(quote1trigger,''' '); filltrigger(quote2trigger,'" '); resettrigger(defaulttrigger); resettrigger(gettrigger); resettrigger(nametrigger); resettrigger(piecetrigger); resettrigger(settrigger); resettrigger(begincomment); resettrigger(begincurly); resettrigger(quote1trigger); resettrigger(quote2trigger); indefault := false; if not eof(book) then begin (* if there is still more to the book ... *) getpiece(book,theline,pie); (* read in the piece *) if not eof(book) then begin (* if we found a piece ... *) length:=pietoint(pie^.key.pieend,pie); (* calculate piece length *) (* now find in inst the next occurance of 'get' *) done := false; while not done do begin if eof(inst) then begin (* no instructions? *) alignedbase := 1; (* simply align by the first base *) done := true end else begin if eoln(inst) then readln(inst) {then rdln(inst)} else begin {rd(inst,ch);} read(inst,ch); testfortrigger(ch, begincomment); testfortrigger(ch, begincurly); if begincomment.found or begincurly.found then begin if ch = '*' then begin skipcomment(inst); resettrigger(begincomment); end else begin resettrigger(begincurly); skipcurly(inst); end end else begin (* we are not inside a comment *) testfortrigger(ch, gettrigger); if gettrigger.found then begin findnonblank(inst,ch); (* get to "from" *) findblank(inst); (* get past "from" *) read(inst,thebase); (* read in the alignedbase *) {writeln(output);writeln(output,'thebase = ',thebase:1);} alignedbase:=pietoint(thebase,pie); {writeln(output,'alignedbase=',alignedbase:1);} done := true end; testfortrigger(ch, quote1trigger); if quote1trigger.found then begin skipquote(quote1trigger); end; testfortrigger(ch, quote2trigger); if quote2trigger.found then begin skipquote(quote2trigger); end; testfortrigger(ch, defaulttrigger); if defaulttrigger.found then begin indefault := true; resettrigger(defaulttrigger) end; if ch = semicolon then indefault := false; testfortrigger(ch, settrigger); if settrigger.found then begin indefault := true; resettrigger(settrigger) end; if ch = semicolon then indefault := false; (* check that piece names are correct *) testfortrigger(ch, piecetrigger); if not indefault then if piecetrigger.found then begin skipblanks(inst); (* get to name *) with pie^.key.hea.keynam do begin for p := 1 to length do begin read(inst,ch); if letters[p] <> ch then begin writeln(output,'The piece name in the book: '); writeln(output,letters:length); writeln(output,'does not match', ' the inst file piece name:'); (* write the letters that matched: *) for p1 := 1 to p-1 do write(output,letters[p1]); (* write the offending letter: *) write(output, ch); (* get the rest of the name and show it: *) done := eoln(inst); while not done do begin done := eoln(inst); if not done then begin read(inst,ch); if (ch = ' ') or (ch = ';') then done := true; if not done then write(output,ch); end; end; writeln(output); (* mark the first letter that does not match: *) for p1 := 1 to p-1 do write(output,' '); write(output,'^'); writeln(output); halt end; end end; end; end end end end; if (alignedbase <= -maximumrange) or (alignedbase > length + maximumrange) then begin writeln(output,' In procedure align:'); writeln(output,' read in base was ',thebase:1); writeln(output,' in internal coordinates: ',alignedbase:1); writeln(output,' maximum range was ',maximumrange:1); writeln(output,' piece length was ',length:1); with pie^.key.hea.keynam do writeln(output,' piece name: ',letters:length); writeln(output,' piece number: ',number:1); writeln(output,' aligned base is too far away... see the code'); halt end end end end; (* end module align.align version = 7.67; {of delmod.p 2004 Sep 8} *) (* ************************************************************************ *) (* end module package.align version = 7.67; {of delmod.p 2004 Sep 8} *) (******************************************************************************) (* begin module align.withinalignment *) function withinalignment(alignedposition, alignedbase, length: integer) :boolean; (* this function tells one if an aligned position, relative to an aligned base in a piece of some length is within the piece. *) var p: integer;(* the position on the piece *) begin p := alignedposition + alignedbase; withinalignment := (p>0) and (p<=length) end; (* end module align.withinalignment version = 7.67; {of delmod.p 2004 Sep 8} *) (* begin module book.getbase *) function getbase(position: integer; pie: pieceptr):base; (* Get a base from the position (internal coordinates) of the piece. Protection is made against positions outside the piece. In the case of circles it would be convenient to wrap around when requests are off the end. So the routine will do a modular wrap for positions outside the range 1 to the length. This is a new feature as of 2000 March 22. *) var workdna: dnaptr; (* pointer to the dna part of pie *) p: integer; (* current count of bases into the workdna *) spot: integer; (* the last base of the dna part *) thelength: integer; (* the length of the piece *) begin { writeln(output,'NEW getbase: position=',position:1,'^^^^^^^^^^^^^^^^^^^^'); } (* handle cases of position out of range by circular wrapping *) thelength := piecelength(pie); while position < 1 do position := position + thelength; while position > thelength do position := position - thelength; workdna:=pie^.dna; p:=workdna^.length; while position > p do begin { writeln(output,' workdna^.length=',workdna^.length:1); } workdna := workdna^.next; if workdna = nil then begin writeln(output,'error in function getbase!'); halt end; p := p + workdna^.length; end; { writeln(output,'p=',p:1); } if workdna = nil then begin writeln(output,'error in getbase: request off end of piece'); halt end else begin spot := workdna^.length - (p-position); { writeln(output,'spot=',spot:1); showdnasegment(output,workdna, spot); } if (spot <= 0) then begin writeln(output,'error in getbase, spot (= ',spot:1, ') must be positive'); halt end; if (spot > workdna^.length) then begin writeln(output,'error in getbase, spot (=',spot:1, ') must be less than length (=',workdna^.length:1,')'); halt end; { writeln(output,'base = ', workdna^.part[spot]); } getbase:=workdna^.part[spot] end end; (* end module book.getbase version = 7.67; {of delmod.p 2004 Sep 8} *) (* begin module book.name *) procedure clearname(var n: name); (* clear the name n *) var i: integer; (* index to piece name *) begin n.length := 0; for i := 1 to namelength do n.letters[i] := ' '; end; procedure writename(var f: text; n: name); (* write the name n to file f *) var i: integer; (* index to piece name *) begin for i := 1 to n.length do write(f,n.letters[i]); end; procedure copyname(a: name; var b: name); (* copy name a to name b *) var i: integer; (* index to piece name *) begin for i := 1 to a.length do b.letters[i] := a.letters[i]; b.length := a.length; end; function equalname(a,b: name): boolean; (* is name a equal to name b? *) var i: integer; (* index to piece name *) same: boolean; (* temporary variable to hold the answer *) begin same := true; (* what optimism!! *) if b.length = a.length then begin i := 1; while same and (i <= a.length) do begin same := (b.letters[i] = a.letters[i]); i := succ(i); end end else same := false; equalname := same; end; (* end module book.name version = 7.67; {of delmod.p 2004 Sep 8} *) (* begin module book.brorgkey *) procedure brorgkey(var thefile: text; var theline: integer; var org: orgkey); (* read organism key *) begin with org do begin {bbb} brheader(thefile,theline,hea); getline(mapunit); brline(thefile,theline,mapunit); end end; (* end module book.brorgkey version = 7.67; {of delmod.p 2004 Sep 8} *) (* begin module book.brchrkey *) procedure brchrkey(var thefile: text; var theline: integer; var chr: chrkey); (* read chromosome key *) begin with chr do begin {bbb} brheader(thefile,theline,hea); brreanum(thefile,theline,mapbeg); brreanum(thefile,theline,mapend); end end; (* end module book.brchrkey version = 7.67; {of delmod.p 2004 Sep 8} *) (* begin module book.getocp *) procedure getocp(var thefile: text; var theline: integer; var org: orgkey; var orgchange, orgopen: boolean; var chr: chrkey; var chrchange, chropen: boolean; var pie: pieceptr; var piechange, pieopen: boolean); (* Get the next piece and its organism and chromosome keys. The three change variables indicate whether or not a new organism, chromosome or piece name was found. If a piece is not found, then pieopen will be false. orgopen, chropen and pieopen are used by getocp to tell when it has entered an organism, chromosome or piece. All booleans should be set to false initially. There should be one triplet for each book read. It is important to initialize ALL variables, including pie: orgchange := false; orgopen := false; chrchange := false; chropen := false; piechange := false; pieopen := false; pie := nil; theline := 0; 1999 June 2 The book reading routines now treat data objects more precisely. Rather than test for eof, the endo of book occurs when pieopen is returned as false. A book reading loop now looks like this: repeat getocp(book, theline, org, orgchange, orgopen, chr, chrchange, chropen, pie, piechange, pieopen); writeln(output,'pieopen: ',pieopen); if pieopen then begin writeln(output,'piece at line: ',theline:1); end; until not pieopen; *) var ch: char; newchr: chrkey; neworg: orgkey; newpie: pieceptr; begin ch:='a'; while not (ch in [' ','p']) do begin ch:=getto(thefile,theline,['o','c','p']); if ch <> ' ' then begin case ch of 'o': if orgopen then begin readln(thefile); (* move past the word 'organism' - new definition 1999 Mar 13 *) orgopen:=false (* close organism *) end else begin brorgkey(thefile,theline,neworg); if (neworg.hea.keynam.letters <> org.hea.keynam.letters) and (neworg.hea.keynam.length <> org.hea.keynam.length) then begin { writeln(output,'--------orgchanged!'); write (output,'--------old org:"', org.hea.keynam.letters); writeln(output, '" ', org.hea.keynam.length:1); write (output,'--------new org:"',neworg.hea.keynam.letters); writeln(output, '" ',neworg.hea.keynam.length:1); } (*ccc*) orgchange:=true; copyheader(neworg.hea,org.hea); (* move the mapunit over to the org! *) org.mapunit := neworg.mapunit; clearline(neworg.mapunit); end else orgchange:=false; orgopen:=true; end; 'c': if chropen then begin readln(thefile); (* move past the word 'chromosome' - new definition 1999 Mar 13 *) chropen:=false (* close chromosome *) end else begin brchrkey(thefile,theline,newchr); if (newchr.hea.keynam.letters <> chr.hea.keynam.letters) and (newchr.hea.keynam.length <> chr.hea.keynam.length) then begin { writeln(output,'--------chrchanged!'); write (output,'--------old chr:"', chr.hea.keynam.letters); writeln(output, '" ', chr.hea.keynam.length:1); write (output,'--------new chr:"',newchr.hea.keynam.letters); writeln(output, '" ',newchr.hea.keynam.length:1); } chrchange:=true; copyheader(newchr.hea,chr.hea); (* move the map range over to the chr! *) chr.mapbeg := newchr.mapbeg; chr.mapend := newchr.mapend; end else chrchange:=false; chropen:=true; end; 'p': if pieopen then begin pieopen:=false; (* close last piece *) ch:='a' (* prevent falling out of the loop *) end else begin new(newpie); brpiece(thefile,theline,newpie); if pie = nil then piechange := true else begin if (newpie^.key.hea.keynam.letters <> pie^.key.hea.keynam.letters) and (newpie^.key.hea.keynam.length <> pie^.key.hea.keynam.length) then begin piechange:=true; end else piechange:=false; end; pieopen:=true; (* we always have to switch over to the new piece, because although the name may be the same, the DNA sequence could be different. That is, the book may contain two pieces with the same name, and we want to be sure to search the new one, not the old one. *) if pie <> nil then begin clearpiece(pie); (* save the links *) dispose(pie); (* close up shop *) end; pie := newpie; end end end else begin pieopen := false end end end; (* origin: search version = 6.39 *) (* end module book.getocp version = 7.67; {of delmod.p 2004 Sep 8} *) (* ************************************************************************ *) (* ************************************************************************ *) (* ************************************************************************ *) (* begin module book.iwname *) procedure iwname(var thefile: text; thename: name); (* write the name to the file *) var c: integer; begin for c:=1 to thename.length do write(thefile, thename.letters[c]) end; (* end module book.iwname version = 7.67; {of delmod.p 2004 Sep 8} *) (* begin module book.iworg *) procedure iworg(var afile: text; org: orgkey); (* write an organism specification. no writeln is done to allow write orgchr to do this. *) begin write(afile,'organism '); iwname(afile,org.hea.keynam); write(afile,';'); end; (* end module book.iworg version = 7.67; {of delmod.p 2004 Sep 8} *) (* begin module book.iwchr *) procedure iwchr(var afile: text; chr: chrkey); (* write an chromosome specification. no writeln is done to allow write orgchr to do this. *) begin write(afile,'chromosome '); iwname(afile,chr.hea.keynam); write(afile,';'); end; (* end module book.iwchr version = 7.67; {of delmod.p 2004 Sep 8} *) (* begin module book.iwpie *) procedure iwpie(var afile: text; pie: piekey); (* write a piece specification *) begin write(afile,'piece '); iwname(afile,pie.hea.keynam); writeln(afile,';'); end; (* end module book.iwpie version = 7.67; {of delmod.p 2004 Sep 8} *) (* begin module book.iworgchr *) procedure iworgchr(var afile: text; org: orgkey; orgchange, orgopen: boolean; chr: chrkey; chrchange, chropen: boolean); (* write both organism and chromosome specifications, based on whether the organism or chromosome changed (orgchange and chrchange) and whether they are currently open (orgopen, chropen). See getocp in the br routines. *) begin if orgchange and orgopen then iworg(afile,org); if orgchange and chrchange and orgopen and chropen then write(afile,' '); if chrchange and chropen then iwchr(afile,chr); if (orgchange and orgopen) or (chrchange and chropen) then writeln(afile) end; (* end module book.iworgchr version = 7.67; {of delmod.p 2004 Sep 8} *) (* begin module book.iwget *) procedure iwget(var afile: text; pie: pieceptr; fromplace, pieceplace, toplace: integer; flip: boolean; insttype: integer; carriagereturn: boolean); (* print a get delila instruction in the orientation of pie, from fromplace to toplace pieceplace. +/- direction; If flip is false, the piece direction is as on the piece, if it is true, the it is the opposite direction. insttype: instruction type. insttype=1 means the form get from p -/+f to same +/-t dir +/-; insttype=2 means the form get from p1 -/+f to p2 +/-t dir +/-; where p, p1 and p2 are locations carriagereturn: if true, add a carriage return to the end of the line. *) procedure iwposition(relative: integer; sameallowed: boolean); (* write the *) procedure iwrelative(relative: integer); begin if relative>=0 then write(afile,' +', relative:1) else if relative< 0 then write(afile,' ',relative:1) end; begin (* iwposition *) if (insttype = 1) and sameallowed then write(afile,' same') else write(afile,' ',pieceplace:1); case pie^.key.piedir of plus: iwrelative(+relative); minus: iwrelative(-relative); end end; begin (* iwget *) write(afile,'get from'); iwposition(fromplace, false); write(afile,' to'); iwposition(toplace, true); write(afile,' direction'); case pie^.key.piedir of dirhomologous, (* handle case, may not be right *) plus: case flip of false: write(afile,' +'); true: write(afile,' -'); end; dircomplement, (* handle case, may not be right *) minus: case flip of false: write(afile,' -'); true: write(afile,' +'); end end; write(afile,';'); if carriagereturn then writeln(afile); end; (* end module book.iwget version = 7.67; {of delmod.p 2004 Sep 8} *) (* begin module book.iwgetsimple *) procedure iwgetsimple(var afile: text; pie: pieceptr; fromplace, toplace: integer; flip: boolean; carriagereturn: boolean); (* print a get delila instruction in the orientation of pie, from fromplace to toplace pieceplace. +/- direction; If flip is false, the piece direction is as on the piece, if it is true, the it is the opposite direction. Format: get from [pieceplace+fromplace] to [pieceplace+ toplace] +/- direction; where [] means to precompute the value. carriagereturn: if true, add a carriage return to the end of the line. *) begin (* iwget *) write(afile,'get from'); write(afile,' ',fromplace:1); write(afile,' to'); write(afile,' ', toplace:1); write(afile,' direction'); case pie^.key.piedir of dirhomologous, (* handle case, may not be right *) plus: case flip of false: write(afile,' +'); true: write(afile,' -'); end; dircomplement, (* handle case, may not be right *) minus: case flip of false: write(afile,' -'); true: write(afile,' +'); end end; write(afile,';'); if carriagereturn then writeln(afile); end; (* end module book.iwgetsimple version = 7.67; {of delmod.p 2004 Sep 8} *) (* ************************************************************************ *) (* ************************************************************************ *) (* ************************************************************************ *) (* begin module package.numbar *) (* ************************************************************************ *) (* begin module numberdigit *) function numberdigit(number, logplace:integer): char; (* return the digit at the place value ('logplace') position of number. example: numberdigit(13625, 3) = 3 numberdigit(13625, 4) = 1 2000 July 30 'myabsolute' replaced 'absolute', which is apparently a keyword for GPC. The name is kept to keep the code looking similar to its origin. *) var place: integer; (* the exponent of logplace *) count: integer; (* used to make place *) myabsolute: integer; (* the absolute value of number *) acharacter: char; (* the character to be returned *) procedure digit; (* extract a digit at the place position *) var tenplace: integer; (* ten times place *) z: integer; (* an intermediate value *) d: integer; (* the digit extracted *) begin (* digit *) tenplace:=10*place; z:=myabsolute-((myabsolute div tenplace)*tenplace); if place = 1 then d:=z else d:= z div place; case d of 0: acharacter:='0'; 1: acharacter:='1'; 2: acharacter:='2'; 3: acharacter:='3'; 4: acharacter:='4'; 5: acharacter:='5'; 6: acharacter:='6'; 7: acharacter:='7'; 8: acharacter:='8'; 9: acharacter:='9'; end end; (* digit *) procedure sign; (* put a negative sign out or a positive sign *) begin (* sign *) if number <0 then acharacter:='-' else acharacter:='+' end; (* sign *) begin (* numberdigit *) place:=1; for count:=1 to logplace do place:=10*place; if number=0 then begin if place=1 then acharacter:='0' else acharacter:=' ' end else begin myabsolute:=abs(number); if myabsolute < (place div 10) then acharacter:=' ' else if myabsolute >= place then digit else sign end; numberdigit:=acharacter end; (* numberdigit *) (* end module numberdigit version = 4.86; (@ of prgmod.p 2004 Sep 8 *) (* begin module numbersize *) function numbersize(n: integer):integer; (* calculate amount of space to be reserved for the integer n *) const ln10 = 2.30259; (* natural log of 10 - for conversion to log base 10 *) epsilon = 0.00001; (* a small number to correct log base 10 errors *) var size: integer; (* intermediate result *) begin (* numbersize *) if n = 0 then numbersize:=1 else begin size:=trunc(ln(abs(n))/ln10 + epsilon) + 1; (* the 1 is for the last digit *) (* the epsilon assures that we do not lose a place due to roundoff. eg, sometimes log base 10 of 10 would be 0.9999 instead of 1, and we would not do it right... note: this will fail for very large numbers on the order of 1/epsilon. *) if n < 0 then size := succ(size); (* account for minus sign *) numbersize := size; end end; (* numbersize *) (* end module numbersize version = 4.86; (@ of prgmod.p 2004 Sep 8 *) (* begin module numberbar *) function firstlastmax(firstnumber, lastnumber: integer): integer; (* compute the sizes of firstnumber and lastnumber (including + or - sign) and then determine which number is larger *) var firstlines: integer; (* number of lines needed for firstumber *) lastlines: integer; (* number of lines needed for lastnumber *) begin firstlines := numbersize(firstnumber); if firstnumber > 0 then firstlines := firstlines + 1; (* add one more for + sign *) lastlines := numbersize(lastnumber); if lastnumber > 0 then lastlines := lastlines + 1; (* add one more for + sign *) if firstlines > lastlines then firstlastmax := firstlines else firstlastmax := lastlines; end; procedure numberbar(var afile: text; spaces, firstnumber, lastnumber: integer; var linesused: integer); (* write a bar of numbers to a file, with several spaces before. the number of lines used is returned *) var logplace: integer; (* the log of the digit being looked at *) number: integer; (* the current number being written *) spacecount: integer; (* count of spaces *) begin { 2000 June 24: This code was not sufficient to deal with the sign correctly. The numbersize routine now does *not* give the + sign (which makes it useful for other purposes) so we have to account for it here now. if abs(firstnumber) > abs(lastnumber) then linesused:= numbersize(firstnumber) else linesused:= numbersize(lastnumber); } linesused := firstlastmax(firstnumber, lastnumber); { writeln(output,'numberbar says linesused = ',linesused:1); for logplace:=linesused-1 downto 0 do begin 1999 July 15: this is changed to linesused since numbersize now accounts for the sign: for logplace := linesused downto 0 do begin 2000 June 24: back to the old code ... } for logplace := linesused-1 downto 0 do begin for spacecount:=1 to spaces do write(afile,' '); for number:=firstnumber to lastnumber do write(afile,numberdigit(number,logplace)); writeln(afile) end end; (* end module numberbar version = 4.86; (@ of prgmod.p 2004 Sep 8 *) (* ************************************************************************ *) (* end module package.numbar version = 4.86; (@ of prgmod.p 2004 Sep 8 *) (* begin module space *) procedure space(var afile: text; spaces: integer); (* space over some amount to file afile. *) var spacecount: integer; (* count of spaces *) begin for spacecount:=1 to spaces do write(afile,' '); end; (* end module space *) (* begin module sebo.readparameters *) procedure readparameters(var sebop: text; (* the parameter file to read *) var parameterversion: real; var alignmenttype: char; var fromdo, todo: integer; var rangecontrol: char; var frominst, toinst: integer; var mismatches: integer; var alertinterval: integer); (* read the parameters as defined in the main routine. *) begin reset(sebop); readln(sebop, parameterversion); { writeln(output,'parameterversion:', parameterversion:40:38); writeln(output,'updateversion:', updateversion:40:38); } if round(100*parameterversion) < round(100*updateversion) then begin writeln(output, 'You have an old parameter file!'); halt end; readln(sebop, alignmenttype); readln(sebop, fromdo, todo); if fromdo > todo then begin writeln(output,'fromdo (',fromdo:1, ') must be less than todo (',todo:1,')'); halt end; if sebop^ in ['a','r'] then begin readln(sebop, rangecontrol); frominst := 0; toinst := 0; end else begin readln(sebop, frominst, toinst); if frominst > toinst then begin writeln(output,'frominst (',frominst:1, ') must be less than toinst (',toinst:1,')'); halt end; end; readln(sebop, mismatches); if mismatches < 0 then begin writeln(output,'mismatches must be non-negative'); halt end; readln(sebop, alertinterval); end; (* end module sebo.readparameters *) (* begin module sebo.writeparameters *) procedure writeparameters(var afile: text; alignmenttype: char; fromdo, todo: integer; rangecontrol: char; frominst, toinst: integer; mismatches: integer; alertinterval: integer); (* write the parameters to afile. *) const wid = 10; (* width of output numbers *) begin case alignmenttype of 'f': writeln(afile,'f: force alignment on first base'); 'i': writeln(afile,'i: use the alignedbase from the book'); 'b': writeln(afile,'b: use the internal book'); end; writeln(afile, fromdo:wid, ' ',todo:wid, ' range of book alignment used for search'); if not (rangecontrol in ['a','r']) then begin writeln(afile, frominst:wid, ' ',toinst:wid, ' range of resulting output instructions'); end else begin write (afile, rangecontrol, ' ':wid, ' ':wid); if rangecontrol = 'r' then write(afile,' RELATIVE'); if rangecontrol = 'a' then write(afile,' ABSOLUTE'); writeln(afile,' instructions'); end; writeln(afile, mismatches:wid, ' ', ' ':wid, ' mismatches allowed'); writeln(afile, alertinterval:wid,' ', ' ':wid, ' alert interval'); end; (* end module sebo.writeparameters *) (* begin module identifypiece *) procedure identifypiece(var afile: text; var Ppie: pieceptr; carriagereturn: boolean); (* identify the piece Ppie by delila instructions; write result to afile. carriagereturn: if true, add a carriage return to the end of the line. example: piece U00096; get from 637551 to 638151 direction +; *) var Pflip: boolean; (* is the piece flipped? *) begin with Ppie^.key.hea do begin if fulnam <> nil then if fulnam^.length > 0 then begin write(afile, 'name "'); writeline(afile, fulnam, false); write(afile, '"; '); end; end; Pflip := (Ppie^.key.piedir <> Ppie^.key.coodir); write(afile, 'piece '); iwname(afile, Ppie^.key.hea.keynam); write(afile, '; '); if Pflip then iwgetsimple(afile, Ppie, inttopie(1, Ppie), inttopie(piecelength(Ppie), Ppie), not Pflip, false) (* with cr *) else iwgetsimple(afile, Ppie, inttopie(1, Ppie), inttopie(piecelength(Ppie), Ppie), Pflip, false); (* with cr *) if carriagereturn then writeln(afile); end; (* end module identifypiece *) (* begin module sebo.themain *) procedure themain(var inst, book, target, sebop, instout, list: text); (* the main procedure of the program *) var alertinterval: integer; (* interval in bases to tell the user we are still hard at work *) alignedbase: integer; (* the aligning base of Bpie *) alignmenttype: char; (* 'f' means alignment by First internal coordinate base, 'b' means alignment by Book, 'i' means alignment by Instructions *) done: boolean; (* done searching this Bpie against this Tpie? *) parameterversion: real; (* parameter version number *) Bflip: boolean; (* probe direction = target direction? *) Tflip: boolean; (* target pie = target coo? *) found: boolean; (* the sequence was found in the target? *) fromdo, todo: integer; (* user defined range to use for searching *) frominst, toinst: integer; (* range of resulting instout instructions *) hits: integer; (* number of probes found in target *) indent: integer; (* amount to indent book pieces on display *) insttype: integer; (* type of instructions to write out; see iwget *) l: integer; (* aligned position *) linesused: integer; (* line count from numberbar *) mismatches: integer; (* number of mismatches allowed *) misses: integer; (* number of mismatches found so far *) probenumber: integer; (* count of probes *) rangecontrol: char; (* control of output range. 'a': absolute coordinates; 'r': relative; other: frominst to toinst *) targetnumber: integer; (* count of targets *) thefulnam: lineptr; (* the current name to use in instout. It will default to the previous name. *) totalprobes: integer; (* total number of probes found in target *) (* book pieces of DNA to search with *) Btheline: integer; (* location in the book *) Borg: orgkey; Borgchange, Borgopen: boolean; Bchr: chrkey; Bchrchange, Bchropen: boolean; Bpie: pieceptr; Bpiechange, Bpieopen: boolean; Blength: integer; (* length of Bpie *) Bbase: base; (* a base in the book sequence *) Bposition: integer; (* position on Bpie *) (* target piece to search *) Ttheline: integer; (* location in the target book *) Torg: orgkey; Torgchange, Torgopen: boolean; Tchr: chrkey; Tchrchange, Tchropen: boolean; Tpie: pieceptr; Tpiechange, Tpieopen: boolean; Tlength: integer; (* length of Tpie *) Tbase: base; (* a base in the target book sequence *) Tposition: integer; (* position on Tpie *) procedure showalignment(var fout: text; t: integer); (* show the alignment to file fout for coordinate t *) var index: integer; (* index to the book sequence *) begin (* show the probe sequence *) writeln(fout); numberbar(fout, indent, fromdo, todo, linesused); space(fout, indent); for index := fromdo to todo do begin if withinalignment(index, alignedbase, Blength) then begin Bbase := getbase(index+alignedbase, Bpie); write(fout, basetochar(Bbase)); end else begin write(fout, ' '); end; end; writeln(fout, ' probe'); (* show the probe-target differences *) if misses > 0 then begin space(fout, indent); for index := fromdo to todo do begin if withinalignment(index, alignedbase, Blength) and withinalignment(index, t, Tlength) then begin if getbase(index+alignedbase, Bpie) = getbase(index+t, Tpie) then write(fout, ' ') else write(fout, 'X'); end else begin write(fout, ' '); end; end; writeln(fout, ' differences'); end; (* show the target sequence if it differs from the probe *) if misses > 0 then begin space(fout, indent); for index := fromdo to todo do begin if withinalignment(index, t, Tlength) then begin Tbase := getbase(index+t, Tpie); write(fout, basetochar(Tbase)); end else begin write(fout, ' '); end; end; writeln(fout, ' target'); end; (* show the zero base location *) space(fout, indent); space(fout, abs(fromdo)); write(fout,'^ found at ', inttopie(t, Tpie):1); writeln(fout,' on the target'); writeln(fout); end; (* showalignment *) procedure copyline(a: lineptr; var b: lineptr); (* copy the contents of line a to b *) var index: integer; (* index to characters in l *) begin for index := 1 to a^.length do b^.letters[index] := a^.letters[index]; b^.length := a^.length; end; procedure writeinstructions(var instout: text; t: integer); (* write instructions out for coordinate t *) begin writeln(instout); (* 2009 Mar 3: this code gave entirely wrong coordinates - 8065429 on the E. coli genome! - replace with identifypiece below. writeln(instout,'{ BUBBA original source probe: }'); *){ write(instout,'{'); if Bpie^.key.hea.fulnam^.length <> 0 then begin write(instout,' name "'); writeline(instout, Bpie^.key.hea.fulnam, false); write(instout,'";'); end; write(instout,' piece '); iwname(instout, Bpie^.key.hea.keynam); write(instout,'; '); if Bflip then iwgetsimple(instout, Bpie, inttopie(Bpie^.key.pieend,Bpie), inttopie(Bpie^.key.piebeg,Bpie), Bflip, false) (* with cr *) else iwgetsimple(instout, Bpie, inttopie(Bpie^.key.piebeg,Bpie), inttopie(Bpie^.key.pieend,Bpie), Bflip, false); (* with cr *) } (* writeln(instout,' }'); *) (* 2009 Mar 3 search target as reported to output *) writeln(instout, '{Searching target ',targetnumber:1, ' with probe ',probenumber:1,': '); identifypiece(instout, Bpie, false); writeln(instout, ' }'); writeln(instout,'{ final target instructions: }'); if Bpie^.key.hea.fulnam^.length <> 0 then begin write(instout,'name "'); writeline(instout, Bpie^.key.hea.fulnam, false); write(instout,'"; '); end; {original: iwget(instout, Tpie, frominst, inttopie(t, Tpie), toinst, Tflip, insttype, false); This gave the wrong instruction in the case that the target was flipped. Force it to be correct: } if not (rangecontrol in ['a','r']) then begin iwget(instout, Tpie, frominst, inttopie(t, Tpie), toinst, false, insttype, true); end else begin case rangecontrol of 'a': begin (* absolute instructions *) iwget(instout, Tpie, frominst, inttopie(t, Tpie), frominst + (piecelength(Bpie)-1), { may need orientation stuff here } false, 2, true); end; 'r': begin (* relative instructions *) iwget(instout, Tpie, 0, (* relative is from the given coordinate *) inttopie(t, Tpie), piecelength(Bpie)-1, (* base 0 counts as one *) false, insttype, true); end; end; end; (* writeln(instout); write(instout,' {'); writeln(instout,'frominst: ', frominst:1); writeln(instout,' toinst: ', toinst:1); if Tflip then writeln(instout,'Tflip is true') else writeln(instout,'Tflip is false'); if Bflip then writeln(instout,' Bflip is true') else writeln(instout,' Bflip is false'); write(instout,' }'); *) end; (* writeinstructions *) procedure announceTarget(var fout: text); (* announce the Target sequence to file fout *) begin writeln(fout); writeln(fout,'Target sequence: '); identifypiece(fout, Tpie, false); writeln(fout,' { ',Tlength:1,' bases }'); end; (* announceTarget *) procedure announceProbe(var fout: text); (* announce the Probe sequence to file fout *) begin space(fout, indent); writeln(fout, 'Searching target ',targetnumber:1, ' with probe ',probenumber:1,': '); identifypiece(fout, Bpie, true); end; (* announceProbe *) procedure usingpreviousname(var fout: text); (* make an announcement to fout about the probe name *) begin write(fout,'{ Using a previous probe full name: "'); writeline(fout,thefulnam, false); writeln(fout,'" as the full name for the next probe. }'); end; (* usingpreviousname *) procedure reporthits(var fout: text); (* make an announcement to fout of the number of probes found *) begin if hits = 0 then begin write(fout,'{ probe'); if thefulnam^.length <> 0 then begin write(fout,' "'); writeline(fout,thefulnam, false); write(fout,'"'); end; writeln(fout,' was not found in the target. }'); end else if hits > 1 then begin write(fout,'{ probe "'); writeline(fout,thefulnam, false); writeln(fout,'" was found ',hits:1, ' times in the target. }'); end end; (* reporthits *) procedure dosearch; (* we now have the book piece and the target, so we can search *) var t: integer; (* position on Tpie that we are checking against Bposition *) begin case alignmenttype of 'f': alignedbase := 1; (* force alignment on first base *) 'i': ; (* use the alignedbase from the inst *) 'b': alignedbase := pietoint(0, Bpie); (* use the internal book *) end; hits := 0; { writeln(output,'Blength = ',Blength:1,' ================='); writeln(output,'fromdo = ',fromdo:1,' ================='); writeln(output,'todo = ',todo:1,' ================='); } for t := 1 to Tlength do begin if alertinterval > 0 then if (t mod alertinterval) = 0 then writeln(output, '... ',inttopie(t,Tpie):1); done := false; found := true; l := fromdo; misses := 0; while (l <= todo) and found do begin (* location on B of the base to compare: *) Bposition := l + alignedbase; (* make sure we are using only the book sequence! *) if (Bposition >= 1) and (Bposition <= Blength) then begin (* location on T of the base to compare: *) Tposition := t + l; (* circular wrap for target: *) if Tposition < 1 then Tposition := Tposition + Tlength; if Tposition > Tlength then Tposition := Tposition - Tlength; Tbase := getbase(Tposition, Tpie); Bbase := getbase(Bposition, Bpie); if Bbase <> Tbase then begin misses := succ(misses); if misses > mismatches then found := false; end; end; l := succ(l); end; if found then begin showalignment(output,t); showalignment(list,t); writeinstructions(instout,t); hits := succ(hits); totalprobes := totalprobes + hits; end; end; reporthits(output); reporthits(list); reporthits(instout); end; (* dosearch *) begin (* themain *) writeln(output,'sebo ',version:4:2); readparameters(sebop, parameterversion, alignmenttype, fromdo, todo, rangecontrol, frominst, toinst, mismatches, alertinterval); writeparameters(output, alignmenttype, fromdo, todo, rangecontrol, frominst, toinst, mismatches, alertinterval); (* solution to memory leak 2001 Mar 23: *) if alignmenttype = 'i' then begin reset(inst); if eof(inst) then begin writeln(output, 'The sebop requests instructions to be used'); writeln(output, 'but the inst file is empty!'); halt; end; end; rewrite(instout); writeln(instout,'title "sebo ',version:4:2,' search with book";'); writeln(instout,'{ sebop parameters:'); writeparameters(instout, alignmenttype, fromdo, todo, rangecontrol, frominst, toinst, mismatches, alertinterval); writeln(instout,'}'); insttype := 1; rewrite(list); writeln(list,'sebo ',version:4:2,' search with book";'); writeln(list,'sebop parameters:'); writeparameters(list, alignmenttype, fromdo, todo, rangecontrol, frominst, toinst, mismatches, alertinterval); brinit(target, Ttheline); new(Tpie); Torgchange := false; Tchrchange := false; Tpiechange := false; Torgopen := false; Tchropen := false; Tpieopen := false; new(Bpie); Borgchange := false; Bchrchange := false; Bpiechange := false; Borgopen := false; Bchropen := false; Bpieopen := false; linesused := 0; indent := 3; getline(thefulnam); targetnumber := 0; totalprobes := 0; while not eof(target) do begin (* read in the target piece *) writeln(output); writeln(output, 'reading in target book ...'); getocp(target, Ttheline, Torg, Torgchange, Torgopen, Tchr, Tchrchange, Tchropen, Tpie, Tpiechange, Tpieopen); writeln(output, '... done'); iworgchr(instout, Torg, Torgchange, Torgopen, Tchr, Tchrchange, Tchropen); if not eof(target) then begin targetnumber := succ(targetnumber); Tlength := piecelength(Tpie); write(instout,'piece '); writename(instout, Tpie^.key.hea.keynam); writeln(instout, '; { the target sequence is ', Tlength:1,' bases }'); announceTarget(output); announceTarget(list); reset(inst); brinit(book, Btheline); probenumber := 0; while not eof(book) do begin case alignmenttype of 'i': align(inst, book, Btheline, Bpie, Blength, alignedbase); 'b','f': begin getocp(book, Btheline, Borg, Borgchange, Borgopen, Bchr, Bchrchange, Bchropen, Bpie, Bpiechange, Bpieopen); Blength := piecelength(Bpie); end; end; if not eof(book) then begin probenumber := succ(probenumber); (* Determine relative orientation (flip). We want to report instructions in instout that are how to grab the given fragment from the Target, irrespective of how it was obtained from the probe library. So we only care if the target pie is the complement of the coo. *) Tflip := (Tpie^.key.piedir <> Tpie^.key.coodir); Bflip := (Bpie^.key.piedir <> Bpie^.key.coodir); { if Tflip then writeln(output,'Tflip is true') else writeln(output,'Tflip is false'); if Bflip then writeln(output,'Bflip is true') else writeln(output,'Bflip is false'); } { write(output,'Bpie^.key.hea.fulnam= "'); writeline(output,Bpie^.key.hea.fulnam, false); writeln(output,'"'); write(output,'thefulnam = "'); writeline(output,thefulnam, false); writeln(output,'"'); } (* this is the memory of the non-empty previous probe name: *) if Bpie^.key.hea.fulnam^.length <> 0 then copyline(Bpie^.key.hea.fulnam, thefulnam) else if thefulnam^.length <> 0 then begin (* retrieve the previous memory *) usingpreviousname(output); usingpreviousname(list); usingpreviousname(instout); copyline(thefulnam, Bpie^.key.hea.fulnam); end; (* announce the book *) announceProbe(output); announceProbe(list); if Tlength < Blength then begin writeln(output,'Target length is less than probe in book.'); { halt; } end else dosearch; (* solution to memory leak 2001 Mar 23: *) clearpiece(Bpie); end; end; end else begin writeln(output,'No further targets.'); end; end; writeln(output); writeln( output,'probes: ', probenumber:1); writeln( output,'total probes found: ', totalprobes:1); writeln( list,'total probes found: ', totalprobes:1); writeln(instout,'{total probes found: ', totalprobes:1,'}'); writeln(output,'targets: ', targetnumber:1); writeln(output,'sebo search completed'); end; (* end module sebo.themain *) begin themain(inst, book, target, sebop, instout, list); 1: end.