title 'p53.target sites version = 3.13 of p53.main.inst 2002 Aug 30'; default out-of-range reduce-range; default numbering piece; organism H.sapiens; chromosome H.sapiens; piece U28935; name 'mdm2-1'; (* \cite{Zauberman.Oren1995}, *) get from 142 -200 to same +5 direction +; {aaa} get from 143 +4 to same -200 direction -; {bbb} get from 152 -4 to same +200 direction +; {ccc} get from 153 +200 to same -5 direction -; {ddd} piece U28935; name 'mdm2-2'; (* \cite{Zauberman.Oren1995}, *) get from 180 -200 to same +5 direction +; {aaa} get from 181 +4 to same -200 direction -; {bbb} get from 190 -4 to same +200 direction +; {ccc} get from 191 +200 to same -5 direction -; {ddd} piece U51127; name 'Humirf5'; (* \cite{Mori.Arakawa2002}, *) get from 249 -200 to same +7 direction +; {aaa} get from 250 +6 to same -200 direction -; {bbb} get from 261 -6 to same +200 direction +; {ccc} get from 262 +200 to same -7 direction -; {ddd} piece U23824; name 'hMSH2-1'; (* \cite{Scherer.Dooley1996}, *) get from 739 -200 to same +14 direction +; {aaa} get from 740 +13 to same -200 direction -; {bbb} get from 758 -13 to same +200 direction +; {ccc} get from 759 +200 to same -14 direction -; {ddd} piece U23824; name 'hMSH2-2'; (* \cite{Warnick.Strait2001}, *) get from 944 -200 to same +6 direction +; {aaa} get from 945 +5 to same -200 direction -; {bbb} get from 955 -5 to same +200 direction +; {ccc} get from 956 +200 to same -6 direction -; {ddd} piece J05614; name 'PCNA'; (* \cite{Morris.Mathews1996}, *) get from 1038 -200 to same +5 direction +; {aaa} get from 1039 +4 to same -200 direction -; {bbb} get from 1048 -4 to same +200 direction +; {ccc} get from 1049 +200 to same -5 direction -; {ddd} piece AF332559; name 'PUMA'; (* \cite{Yu.Vogelstein2001}, *) get from 288 -200 to same +5 direction +; {aaa} get from 289 +4 to same -200 direction -; {bbb} get from 298 -4 to same +200 direction +; {ccc} get from 299 +200 to same -5 direction -; {ddd} piece M35878; name 'IGF-1'; (* \cite{Bourdon.May1997}, *) get from 5068 -200 to same +6 direction +; {aaa} get from 5069 +5 to same -200 direction -; {bbb} get from 5079 -5 to same +200 direction +; {ccc} get from 5080 +200 to same -6 direction -; {ddd} piece M35878; name 'IGF-2'; (* \cite{Bourdon.May1997}, *) get from 5987 -200 to same +5 direction +; {aaa} get from 5988 +4 to same -200 direction -; {bbb} get from 5997 -4 to same +200 direction +; {ccc} get from 5998 +200 to same -5 direction -; {ddd} piece J05193; name 'ACTA'; (* \cite{Comer.Kumar1998}, *) get from 588 -200 to same +5 direction +; {aaa} get from 589 +4 to same -200 direction -; {bbb} get from 598 -4 to same +200 direction +; {ccc} {MODEL.1} get from 599 +200 to same -5 direction -; {ddd} {MODEL.1} piece J03206; name 'EGFR'; (* \cite{Ludes-Meyers.Deb1996}, *) get from 44 -200 to same +8 direction +; {aaa} get from 45 +7 to same -200 direction -; {bbb} get from 57 -7 to same +200 direction +; {ccc} get from 58 +200 to same -8 direction -; {ddd} piece AF008303; name 'TGF-beta1'; (* \cite{Tan.Sun2000}, *) get from 121 -200 to same +5 direction +; {aaa} get from 122 +4 to same -200 direction -; {bbb} get from 131 -4 to same +200 direction +; {ccc} get from 132 +200 to same -5 direction -; {ddd} piece AF008303; name 'TGF-beta-2'; (* \cite{Tan.Sun2000}, *) get from 999 -200 to same +5 direction +; {aaa} get from 1000 +4 to same -200 direction -; {bbb} get from 1009 -4 to same +200 direction +; {ccc} get from 1010 +200 to same -5 direction -; {ddd} piece L24498; name 'GADD45'; (* \cite{Hollander.Fornace1993}, *) get from 3836 -200 to same +5 direction +; {aaa} get from 3837 +4 to same -200 direction -; {bbb} get from 3846 -4 to same +200 direction +; {ccc} get from 3847 +200 to same -5 direction -; {ddd} piece U96098; name 'CollagenaseIV'; (* \cite{Bian.Sun1997a}, *) get from 15 -14 to same +5 direction +; {aaa} get from 16 +4 to same -15 direction -; {bbb} get from 25 -4 to same +200 direction +; {ccc} get from 26 +200 to same -5 direction -; {ddd} piece U24170; name 'WAF1-1'; (* \cite{El-Deiry.Vogelstein1995}, *) get from 2307 -200 to same +5 direction +; {aaa} get from 2308 +4 to same -200 direction -; {bbb} get from 2317 -4 to same +200 direction +; {ccc} get from 2318 +200 to same -5 direction -; {ddd} piece U24170; name 'WAF1-2'; (* \cite{El-Deiry.Vogelstein1995}, *) (* The coordinates *) get from 3198 -200 to same +5 direction +; {aaa} {MODEL.1} get from 3199 +4 to same -200 direction -; {bbb} {MODEL.1} get from 3208 -4 to same +200 direction +; {ccc} {MODEL.1} get from 3209 +200 to same -5 direction -; {ddd} {MODEL.1} (* represent a 3 bit and a -1.6 bit site. However, there is a spectacular site at 3203/3204 of 12.8 bits! The mutation given in Materials and methods destroys the 12.8 bit site and construct ... *) get from 3203 -200 to same +200 direction +; {aaa} {MODEL.2} get from 3204 +200 to same -200 direction -; {bbb} {MODEL.2} piece U17193; name 'BAX'; (* \cite{Miyashita.Reed1995}, *) get from 492 -200 to same +6 direction +; {aaa} get from 493 +5 to same -200 direction -; {bbb} get from 503 -5 to same +200 direction +; {ccc} get from 504 +200 to same -6 direction -; {ddd} piece AF257772; name 'MCG10'; (* \cite{Zhu.Chen2000}, *) get from 2014 -200 to same +6 direction +; {aaa} get from 2015 +5 to same -200 direction -; {bbb} get from 2025 -5 to same +200 direction +; {ccc} get from 2026 +200 to same -6 direction -; {ddd} piece AF081565; name 'KAI1'; (* \cite{Mashimo.Watabe1998}, *) get from 231 -200 to same +10 direction +; {aaa} get from 232 +9 to same -200 direction -; {bbb} get from 246 -9 to same +200 direction +; {ccc} get from 247 +200 to same -10 direction -; {ddd} (* ********************************************************** *) piece AC026112; name 'APAF1'; (* \cite{Robles.Harris2001}, *) (* According to these authors the relvant sequence is AC026112 (page 6662, right column). According to them the oligo that was shifted was cacctcagacatgtctggagaccctaggacgacaagcccagggca (page 6661 left column). A search of AC026112 reveals the oligo at position 46969. Exon 1 of this gene is found in AF098868. *) get from 46979 -200 to same +18 direction +; {aaa} get from 46980 +17 to same -200 direction -; {bbb} get from 47002 -17 to same +200 direction +; {ccc} get from 47003 +200 to same -18 direction -; {ddd} (* OLD: get from 66523 -200 to same +18 direction +; {aaa} get from 66524 +17 to same -200 direction -; {bbb} get from 66546 -17 to same +200 direction +; {ccc} get from 66547 +200 to same -18 direction -; {ddd} *) (* ********************************************************** *) piece AC090307; name 'MASPIN-1'; (* \cite{Zou.Srivastava2000}, *) get from 14135 -200 to same +6 direction +; {aaa} get from 14136 +5 to same -200 direction -; {bbb} get from 14146 -5 to same +200 direction +; {ccc} {MODEL.1} get from 14147 +200 to same -6 direction -; {ddd} {MODEL.1} piece AC090307; name 'MASPIN-2'; (* \cite{Zou.Srivastava2000}, *) get from 14207 -200 to same +10 direction +; {aaa} get from 14208 +9 to same -200 direction -; {bbb} get from 14222 -9 to same +200 direction +; {ccc} get from 14223 +200 to same -10 direction -; {ddd} (* ********************************************************** *) piece L38719; name 'POLD1'; (* \cite{Li.Lee2001}, *) get from 1674 -200 to same +10 direction +; {aaa} get from 1675 +9 to same -200 direction -; {bbb} get from 1689 -9 to same +200 direction +; {ccc} get from 1690 +200 to same -10 direction -; {ddd} piece AF274972; name 'PIDD'; (* \cite{Lin.Benchimol2000}, *) get from 95 -200 to same +13 direction +; {aaa} get from 96 +12 to same -200 direction -; {bbb} get from 113 -12 to same +200 direction +; {ccc} get from 114 +200 to same -13 direction -; {ddd} piece U75285; name 'Survivin'; (* \cite{Hoffman.Murphy2002}, *) get from 2727 -200 to same +8 direction +; {aaa} get from 2728 +7 to same -200 direction -; {bbb} get from 2740 -7 to same +200 direction +; {ccc} get from 2741 +200 to same -8 direction -; {ddd} piece U48705; name 'Tyrosine kinase DDR'; (* \cite{Sakuma.Abe1996}, *) get from 663 -200 to same +5 direction +; {aaa} get from 664 +4 to same -200 direction -; {bbb} get from 673 -4 to same +200 direction +; {ccc} get from 674 +200 to same -5 direction -; {ddd} piece X96438; name 'PRG1'; (* \cite{Schafer.Schmidt1998a}, *) get from 321 -200 to same +5 direction +; {aaa} get from 322 +4 to same -200 direction -; {bbb} get from 331 -4 to same +200 direction +; {ccc} get from 332 +200 to same -5 direction -; {ddd} piece M83094; name 'GPX'; (* \cite{Tan.Sun1999a}, *) get from 2305 -200 to same +5 direction +; {aaa} get from 2306 +4 to same -200 direction -; {bbb} get from 2315 -4 to same +200 direction +; {ccc} get from 2316 +200 to same -5 direction -; {ddd} piece L27475; name 'Caspase-1'; (* \cite{Gupta.Swarup2001}, *) get from 1366 -200 to same +5 direction +; {aaa} get from 1367 +4 to same -200 direction -; {bbb} get from 1376 -4 to same +200 direction +; {ccc} get from 1377 +200 to same -5 direction -; {ddd} piece AY046902; name 'CDC25C'; (* \cite{Resnick-Silverman.Manfredi1998}, *) get from 637 -200 to same +16 direction +; {aaa} get from 638 +15 to same -200 direction -; {bbb} get from 658 -15 to same +200 direction +; {ccc} get from 659 +200 to same -16 direction -; {ddd} piece U18300; name 'DDB2'; (* \cite{Tan.Chu2002}, *) get from 22 -200 to same +6 direction +; {aaa} get from 23 +5 to same -200 direction -; {bbb} get from 33 -5 to same +200 direction +; {ccc} get from 34 +200 to same -6 direction -; {ddd} piece J00277; name 'C-Ha-ras'; (* \cite{Deguin-Chambon.Bourdon2000}, *) get from 1216 -200 to same +9 direction +; {aaa} get from 1217 +8 to same -200 direction -; {bbb} get from 1230 -8 to same +200 direction +; {ccc} get from 1231 +200 to same -9 direction -; {ddd} piece Y07755; name 'S100A2 gene'; (* \cite{Tan.Sun1999b}, *) get from 2515 -200 to same +5 direction +; {aaa} get from 2516 +4 to same -200 direction -; {bbb} get from 2525 -4 to same +200 direction +; {ccc} get from 2526 +200 to same -5 direction -; {ddd} piece AF029081; name '14-3-3 sigma'; (* \cite{Hermeking.Vogelstein1997}, *) (* this case is put at the end of the instructions because this allows removal of the site that has a two base insertion. This allows one to see how the model changes by removing it (in rixyin). *) {This is the -2.9 bit dimer, used in the original model} get from 6758 -200 to same +7 direction +; {aaa} {MODEL.1} get from 6759 +6 to same -200 direction -; {bbb} {MODEL.1} (* {This is the 1.2 bit dimer, which is not used in model 1 } GET from 6760 -200 to same +7 direction +; {aaa} {MODEL.1} GET from 6761 +6 to same -200 direction -; {bbb} {MODEL.1} *) {This is the 11.9 bit dimer} get from 6770 -4 to same +200 direction +; {ccc} get from 6771 +200 to same -5 direction -; {ddd}